Incidental Mutation 'R7212:Golga4'
ID 561156
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 045340-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7212 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118365908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 320 (E320G)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097] [ENSMUST00000212461]
AlphaFold Q91VW5
Predicted Effect possibly damaging
Transcript: ENSMUST00000084820
AA Change: E320G

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: E320G

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212097
AA Change: E320G

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect possibly damaging
Transcript: ENSMUST00000212461
AA Change: E329G

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,138,654 (GRCm39) A193V probably benign Het
Aatf C T 11: 84,340,006 (GRCm39) R435Q probably damaging Het
Abca13 A G 11: 9,248,854 (GRCm39) H2867R probably benign Het
Abcd2 C T 15: 91,043,326 (GRCm39) A621T possibly damaging Het
Actl11 T A 9: 107,805,856 (GRCm39) S60T probably damaging Het
Adam28 T A 14: 68,874,846 (GRCm39) N277I probably damaging Het
Adamts13 T A 2: 26,896,326 (GRCm39) C1240S probably damaging Het
Arhgap27 C T 11: 103,251,581 (GRCm39) R49Q probably damaging Het
Armc10 T C 5: 21,865,581 (GRCm39) S209P probably damaging Het
Atp6v0a1 T C 11: 100,934,783 (GRCm39) F617L probably benign Het
Bap1 T A 14: 30,973,580 (GRCm39) N2K probably damaging Het
Bltp1 C A 3: 37,102,158 (GRCm39) N1363K Het
Cass4 T A 2: 172,269,106 (GRCm39) L396* probably null Het
Ccdc40 A G 11: 119,155,270 (GRCm39) Q1170R probably damaging Het
Cdhr5 C T 7: 140,852,572 (GRCm39) R348H probably damaging Het
Cenpj A G 14: 56,790,109 (GRCm39) S647P probably benign Het
Chordc1 T A 9: 18,206,647 (GRCm39) probably null Het
Chordc1 T C 9: 18,212,308 (GRCm39) S41P probably damaging Het
Ckm T C 7: 19,148,978 (GRCm39) probably null Het
Clca3a1 A C 3: 144,711,727 (GRCm39) I756S probably damaging Het
Clcn1 T C 6: 42,268,323 (GRCm39) V165A possibly damaging Het
Clec4a4 T A 6: 122,968,704 (GRCm39) probably null Het
Cog7 T C 7: 121,576,537 (GRCm39) K130E probably damaging Het
Coq7 A G 7: 118,109,271 (GRCm39) I259T unknown Het
Cp T C 3: 20,029,130 (GRCm39) S536P probably damaging Het
Cyp2d10 T A 15: 82,288,447 (GRCm39) probably null Het
Dcst2 A G 3: 89,273,607 (GRCm39) I162V probably benign Het
Dennd4c A G 4: 86,721,228 (GRCm39) E630G probably damaging Het
Dpt A T 1: 164,624,484 (GRCm39) I62F probably benign Het
Ednrb T A 14: 104,080,444 (GRCm39) I157F probably damaging Het
Ext1 A T 15: 53,208,558 (GRCm39) W68R probably benign Het
Fgf4 A G 7: 144,416,523 (GRCm39) K152E probably benign Het
G530012D18Rik A T 1: 85,504,864 (GRCm39) T90S unknown Het
Galnt17 T C 5: 130,992,949 (GRCm39) T322A possibly damaging Het
Gcm1 A T 9: 77,966,925 (GRCm39) D48V possibly damaging Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gm49358 G T 10: 86,661,071 (GRCm39) R353L probably damaging Het
Herc3 T C 6: 58,895,758 (GRCm39) I1002T probably damaging Het
Hip1r T A 5: 124,111,845 (GRCm39) V7E possibly damaging Het
Hipk1 G A 3: 103,684,926 (GRCm39) Q230* probably null Het
Igsf9b C T 9: 27,242,992 (GRCm39) P726L probably damaging Het
Itgb6 T C 2: 60,464,998 (GRCm39) I345V probably damaging Het
Lhx4 G T 1: 155,600,699 (GRCm39) Q29K probably benign Het
Manba A G 3: 135,273,396 (GRCm39) T777A probably benign Het
Mcm3ap A G 10: 76,337,145 (GRCm39) D1360G probably benign Het
Meltf T A 16: 31,709,632 (GRCm39) probably null Het
Mmp14 T G 14: 54,673,336 (GRCm39) D81E probably damaging Het
Naalad2 T C 9: 18,275,337 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Or7a38 A T 10: 78,753,339 (GRCm39) I222L possibly damaging Het
Or8b35 T A 9: 37,904,253 (GRCm39) M150K possibly damaging Het
Pacs2 A G 12: 113,025,312 (GRCm39) D488G possibly damaging Het
Prr5 T G 15: 84,629,993 (GRCm39) L108R probably null Het
Psg23 A G 7: 18,341,064 (GRCm39) S397P probably benign Het
Rfpl4 C A 7: 5,113,659 (GRCm39) R174L probably damaging Het
Runx3 T A 4: 134,880,090 (GRCm39) I3N probably damaging Het
Scn5a A T 9: 119,372,451 (GRCm39) N214K possibly damaging Het
Slc27a1 T C 8: 72,037,092 (GRCm39) I412T probably damaging Het
Sptbn4 T G 7: 27,116,210 (GRCm39) T530P probably benign Het
Tex15 A T 8: 34,060,854 (GRCm39) R95* probably null Het
Tex15 T C 8: 34,063,023 (GRCm39) S818P probably damaging Het
Tmod1 A T 4: 46,093,951 (GRCm39) K221* probably null Het
Tpm3 G A 3: 89,998,361 (GRCm39) D272N probably benign Het
Trpm6 T C 19: 18,831,155 (GRCm39) V1340A probably benign Het
Ugt2b5 A T 5: 87,273,131 (GRCm39) C512S probably benign Het
Vmn2r82 A T 10: 79,215,268 (GRCm39) E417V probably benign Het
Wfdc11 T C 2: 164,506,366 (GRCm39) N60S probably benign Het
Zfp217 A T 2: 169,956,072 (GRCm39) S975R probably benign Het
Zfr C T 15: 12,146,309 (GRCm39) Q287* probably null Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TAAGCTCATCTCCTCAGTGTTG -3'
(R):5'- ATGAAGGCAGCTTCCCAGAG -3'

Sequencing Primer
(F):5'- CATCTCCTCAGTGTTGGTGTGC -3'
(R):5'- TCCCAGAGGAAGCACAGGC -3'
Posted On 2019-06-26