Incidental Mutation 'R7212:Olfr1354'
ID 561159
Institutional Source Beutler Lab
Gene Symbol Olfr1354
Ensembl Gene ENSMUSG00000094673
Gene Name olfactory receptor 1354
Synonyms GA_x6K02T2QGN0-2895081-2894349, EG257869, MOR139-5, MOR185-8, MOR139-7, GA_x6K02T03FR9-4826-3919, Olfr233-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R7212 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 78913171-78920399 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78917505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 222 (I222L)
Ref Sequence ENSEMBL: ENSMUSP00000144801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075859] [ENSMUST00000204587] [ENSMUST00000217073]
AlphaFold E9Q5G9
Predicted Effect possibly damaging
Transcript: ENSMUST00000075859
AA Change: I222L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093126
Gene: ENSMUSG00000094673
AA Change: I222L

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.4e-49 PFAM
Pfam:7tm_1 42 291 3.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204587
AA Change: I222L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217073
AA Change: I222L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,161,672 A193V probably benign Het
4932438A13Rik C A 3: 37,048,009 N1363K Het
Aatf C T 11: 84,449,180 R435Q probably damaging Het
Abca13 A G 11: 9,298,854 H2867R probably benign Het
Abcd2 C T 15: 91,159,123 A621T possibly damaging Het
Actl11 T A 9: 107,928,657 S60T probably damaging Het
Adam28 T A 14: 68,637,397 N277I probably damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Arhgap27 C T 11: 103,360,755 R49Q probably damaging Het
Arhgap8 T G 15: 84,745,792 L108R probably null Het
Armc10 T C 5: 21,660,583 S209P probably damaging Het
Atp6v0a1 T C 11: 101,043,957 F617L probably benign Het
Bap1 T A 14: 31,251,623 N2K probably damaging Het
Cass4 T A 2: 172,427,186 L396* probably null Het
Ccdc40 A G 11: 119,264,444 Q1170R probably damaging Het
Cdhr5 C T 7: 141,272,659 R348H probably damaging Het
Cenpj A G 14: 56,552,652 S647P probably benign Het
Chordc1 T A 9: 18,295,351 probably null Het
Chordc1 T C 9: 18,301,012 S41P probably damaging Het
Ckm T C 7: 19,415,053 probably null Het
Clca1 A C 3: 145,005,966 I756S probably damaging Het
Clcn1 T C 6: 42,291,389 V165A possibly damaging Het
Clec4a4 T A 6: 122,991,745 probably null Het
Cog7 T C 7: 121,977,314 K130E probably damaging Het
Coq7 A G 7: 118,510,048 I259T unknown Het
Cp T C 3: 19,974,966 S536P probably damaging Het
Cyp2d10 T A 15: 82,404,246 probably null Het
Dcst2 A G 3: 89,366,300 I162V probably benign Het
Dennd4c A G 4: 86,802,991 E630G probably damaging Het
Dpt A T 1: 164,796,915 I62F probably benign Het
Ednrb T A 14: 103,843,008 I157F probably damaging Het
Ext1 A T 15: 53,345,162 W68R probably benign Het
Fgf4 A G 7: 144,862,786 K152E probably benign Het
G530012D18Rik A T 1: 85,577,143 T90S unknown Het
Galnt17 T C 5: 130,964,111 T322A possibly damaging Het
Gcm1 A T 9: 78,059,643 D48V possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm49358 G T 10: 86,825,207 R353L probably damaging Het
Golga4 A G 9: 118,536,840 E320G possibly damaging Het
Herc3 T C 6: 58,918,773 I1002T probably damaging Het
Hip1r T A 5: 123,973,782 V7E possibly damaging Het
Hipk1 G A 3: 103,777,610 Q230* probably null Het
Igsf9b C T 9: 27,331,696 P726L probably damaging Het
Itgb6 T C 2: 60,634,654 I345V probably damaging Het
Lhx4 G T 1: 155,724,953 Q29K probably benign Het
Manba A G 3: 135,567,635 T777A probably benign Het
Mcm3ap A G 10: 76,501,311 D1360G probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mmp14 T G 14: 54,435,879 D81E probably damaging Het
Naalad2 T C 9: 18,364,041 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr881 T A 9: 37,992,957 M150K possibly damaging Het
Pacs2 A G 12: 113,061,692 D488G possibly damaging Het
Psg23 A G 7: 18,607,139 S397P probably benign Het
Rfpl4 C A 7: 5,110,660 R174L probably damaging Het
Runx3 T A 4: 135,152,779 I3N probably damaging Het
Scn5a A T 9: 119,543,385 N214K possibly damaging Het
Slc27a1 T C 8: 71,584,448 I412T probably damaging Het
Sptbn4 T G 7: 27,416,785 T530P probably benign Het
Tex15 A T 8: 33,570,826 R95* probably null Het
Tex15 T C 8: 33,572,995 S818P probably damaging Het
Tmod1 A T 4: 46,093,951 K221* probably null Het
Tpm3 G A 3: 90,091,054 D272N probably benign Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Ugt2b5 A T 5: 87,125,272 C512S probably benign Het
Vmn2r82 A T 10: 79,379,434 E417V probably benign Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Zfp217 A T 2: 170,114,152 S975R probably benign Het
Zfr C T 15: 12,146,223 Q287* probably null Het
Other mutations in Olfr1354
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02903:Olfr1354 APN 10 78917416 missense probably damaging 0.99
IGL02962:Olfr1354 APN 10 78916939 missense probably damaging 1.00
IGL03032:Olfr1354 APN 10 78917637 missense probably benign 0.21
PIT4495001:Olfr1354 UTSW 10 78916987 missense probably benign
R0268:Olfr1354 UTSW 10 78917605 missense probably damaging 0.99
R0359:Olfr1354 UTSW 10 78917343 missense probably benign 0.00
R0382:Olfr1354 UTSW 10 78917126 nonsense probably null
R1895:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R1946:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R2035:Olfr1354 UTSW 10 78917587 missense possibly damaging 0.86
R3853:Olfr1354 UTSW 10 78916947 missense probably damaging 1.00
R4756:Olfr1354 UTSW 10 78917527 missense probably damaging 0.99
R5326:Olfr1354 UTSW 10 78917586 missense possibly damaging 0.86
R5607:Olfr1354 UTSW 10 78917099 missense possibly damaging 0.93
R7070:Olfr1354 UTSW 10 78917268 missense probably benign
R7088:Olfr1354 UTSW 10 78917759 missense probably benign 0.00
R7348:Olfr1354 UTSW 10 78917562 missense probably damaging 1.00
R7386:Olfr1354 UTSW 10 78916843 start codon destroyed probably null 0.98
R7847:Olfr1354 UTSW 10 78916896 missense probably benign 0.02
R8976:Olfr1354 UTSW 10 78917584 missense possibly damaging 0.79
R9267:Olfr1354 UTSW 10 78916969 missense probably damaging 1.00
R9502:Olfr1354 UTSW 10 78917725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCTTACAGAGCTCAATTG -3'
(R):5'- TAAAGGGGTTCAGCATCGGG -3'

Sequencing Primer
(F):5'- GAGCTCAATTGTGCTACAGTTGACC -3'
(R):5'- GGTGACCACAGTATACATCACAGAG -3'
Posted On 2019-06-26