Incidental Mutation 'R7212:Atp6v0a1'
ID561164
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene NameATPase, H+ transporting, lysosomal V0 subunit A1
SynonymsAtp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7212 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101009452-101063719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101043957 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 617 (F617L)
Ref Sequence ENSEMBL: ENSMUSP00000044838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
Predicted Effect probably benign
Transcript: ENSMUST00000044721
AA Change: F617L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: F617L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092663
AA Change: F617L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: F617L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103110
AA Change: F624L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: F624L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168757
AA Change: F617L

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: F617L

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,161,672 A193V probably benign Het
4932438A13Rik C A 3: 37,048,009 N1363K Het
Aatf C T 11: 84,449,180 R435Q probably damaging Het
Abca13 A G 11: 9,298,854 H2867R probably benign Het
Abcd2 C T 15: 91,159,123 A621T possibly damaging Het
Actl11 T A 9: 107,928,657 S60T probably damaging Het
Adam28 T A 14: 68,637,397 N277I probably damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Arhgap27 C T 11: 103,360,755 R49Q probably damaging Het
Arhgap8 T G 15: 84,745,792 L108R probably null Het
Armc10 T C 5: 21,660,583 S209P probably damaging Het
Bap1 T A 14: 31,251,623 N2K probably damaging Het
Cass4 T A 2: 172,427,186 L396* probably null Het
Ccdc40 A G 11: 119,264,444 Q1170R probably damaging Het
Cdhr5 C T 7: 141,272,659 R348H probably damaging Het
Cenpj A G 14: 56,552,652 S647P probably benign Het
Chordc1 T A 9: 18,295,351 probably null Het
Chordc1 T C 9: 18,301,012 S41P probably damaging Het
Ckm T C 7: 19,415,053 probably null Het
Clca1 A C 3: 145,005,966 I756S probably damaging Het
Clcn1 T C 6: 42,291,389 V165A possibly damaging Het
Clec4a4 T A 6: 122,991,745 probably null Het
Cog7 T C 7: 121,977,314 K130E probably damaging Het
Coq7 A G 7: 118,510,048 I259T unknown Het
Cp T C 3: 19,974,966 S536P probably damaging Het
Cyp2d10 T A 15: 82,404,246 probably null Het
Dcst2 A G 3: 89,366,300 I162V probably benign Het
Dennd4c A G 4: 86,802,991 E630G probably damaging Het
Dpt A T 1: 164,796,915 I62F probably benign Het
Ednrb T A 14: 103,843,008 I157F probably damaging Het
Ext1 A T 15: 53,345,162 W68R probably benign Het
Fgf4 A G 7: 144,862,786 K152E probably benign Het
G530012D18Rik A T 1: 85,577,143 T90S unknown Het
Galnt17 T C 5: 130,964,111 T322A possibly damaging Het
Gcm1 A T 9: 78,059,643 D48V possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm49358 G T 10: 86,825,207 R353L probably damaging Het
Golga4 A G 9: 118,536,840 E320G possibly damaging Het
Herc3 T C 6: 58,918,773 I1002T probably damaging Het
Hip1r T A 5: 123,973,782 V7E possibly damaging Het
Hipk1 G A 3: 103,777,610 Q230* probably null Het
Igsf9b C T 9: 27,331,696 P726L probably damaging Het
Itgb6 T C 2: 60,634,654 I345V probably damaging Het
Lhx4 G T 1: 155,724,953 Q29K probably benign Het
Manba A G 3: 135,567,635 T777A probably benign Het
Mcm3ap A G 10: 76,501,311 D1360G probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mmp14 T G 14: 54,435,879 D81E probably damaging Het
Naalad2 T C 9: 18,364,041 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1354 A T 10: 78,917,505 I222L possibly damaging Het
Olfr881 T A 9: 37,992,957 M150K possibly damaging Het
Pacs2 A G 12: 113,061,692 D488G possibly damaging Het
Psg23 A G 7: 18,607,139 S397P probably benign Het
Rfpl4 C A 7: 5,110,660 R174L probably damaging Het
Runx3 T A 4: 135,152,779 I3N probably damaging Het
Scn5a A T 9: 119,543,385 N214K possibly damaging Het
Slc27a1 T C 8: 71,584,448 I412T probably damaging Het
Sptbn4 T G 7: 27,416,785 T530P probably benign Het
Tex15 A T 8: 33,570,826 R95* probably null Het
Tex15 T C 8: 33,572,995 S818P probably damaging Het
Tmod1 A T 4: 46,093,951 K221* probably null Het
Tpm3 G A 3: 90,091,054 D272N probably benign Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Ugt2b5 A T 5: 87,125,272 C512S probably benign Het
Vmn2r82 A T 10: 79,379,434 E417V probably benign Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Zfp217 A T 2: 170,114,152 S975R probably benign Het
Zfr C T 15: 12,146,223 Q287* probably null Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 101030505 critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 101048439 missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 101043802 missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 101039840 missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 101055518 missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 101038851 splice site probably null
R0193:Atp6v0a1 UTSW 11 101048482 missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 101048515 missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0974:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R1460:Atp6v0a1 UTSW 11 101033998 missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 101029204 missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 101055554 missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 101038786 missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 101026685 missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 101044598 missense probably benign
R2926:Atp6v0a1 UTSW 11 101043948 missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 101030420 missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 101055517 missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 101042950 missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 101020515 missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 101043044 missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 101055587 missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 101038807 missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 101029185 missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 101018574 missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 101039889 missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 101055060 missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 101029183 missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 101027357 missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 101034042 missense probably damaging 1.00
X0023:Atp6v0a1 UTSW 11 101044597 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGCTATTTCAAGAAGCCCCTG -3'
(R):5'- CTGAACTCTCCAGAGCTAAGAGG -3'

Sequencing Primer
(F):5'- GAAGCCCCTGAACATCTACTTTGG -3'
(R):5'- ACTCTCCAGAGCTAAGAGGTATAG -3'
Posted On2019-06-26