Mutagenetix > Incidental Mutations

Incidental Mutation 'R7212:Bap1'

561168

Institutional Source

Beutler Lab

Gene Symbol

Bap1

Ensembl Gene

ENSMUSG00000021901

Gene Name

Brca1 associated protein 1

Synonyms

2300006C11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31251450-31259944 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31251623 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 2 (N2K)

Ref Sequence

ENSEMBL: ENSMUSP00000022458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022458] [ENSMUST00000022459] [ENSMUST00000187156] [ENSMUST00000188453] [ENSMUST00000226310] [ENSMUST00000226565] [ENSMUST00000228437] [ENSMUST00000228930]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022458
AA Change: N2K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022458
Gene: ENSMUSG00000021901
AA Change: N2K

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C12	5	215	3e-70	PFAM
low complexity region	282	293	N/A	INTRINSIC
low complexity region	396	407	N/A	INTRINSIC
low complexity region	577	596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000022459

SMART Domains

Protein: ENSMUSP00000022459
Gene: ENSMUSG00000021902

Domain	Start	End	E-Value	Type
PHD	97	145	8.45e-3	SMART
RING	160	207	7.46e-1	SMART
RING	250	300	4.87e0	SMART
PHD	252	301	1.16e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187156

SMART Domains

Protein: ENSMUSP00000139903
Gene: ENSMUSG00000021901

Domain	Start	End	E-Value	Type
low complexity region	33	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188453
AA Change: N2K

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000139824
Gene: ENSMUSG00000021901
AA Change: N2K

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C12	4	137	3.7e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226310

Predicted Effect

probably benign
Transcript: ENSMUST00000226565

Predicted Effect

probably benign
Transcript: ENSMUST00000228437

Predicted Effect

probably benign
Transcript: ENSMUST00000228930

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous deletion of this gene causes delayed embryonic growth and complete lethality during organogenesis. Systemic or hematopoietic-restricted deletion in adults recapitulates features of myelodysplastic syndrome. Heterozygotes show increased incidence of asbestos-induced malignant mesothelioma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	C	T	6: 83,161,672	A193V	probably benign	Het
4932438A13Rik	C	A	3: 37,048,009	N1363K		Het
Aatf	C	T	11: 84,449,180	R435Q	probably damaging	Het
Abca13	A	G	11: 9,298,854	H2867R	probably benign	Het
Abcd2	C	T	15: 91,159,123	A621T	possibly damaging	Het
Actl11	T	A	9: 107,928,657	S60T	probably damaging	Het
Adam28	T	A	14: 68,637,397	N277I	probably damaging	Het
Adamts13	T	A	2: 27,006,314	C1240S	probably damaging	Het
Arhgap27	C	T	11: 103,360,755	R49Q	probably damaging	Het
Arhgap8	T	G	15: 84,745,792	L108R	probably null	Het
Armc10	T	C	5: 21,660,583	S209P	probably damaging	Het
Atp6v0a1	T	C	11: 101,043,957	F617L	probably benign	Het
Cass4	T	A	2: 172,427,186	L396*	probably null	Het
Ccdc40	A	G	11: 119,264,444	Q1170R	probably damaging	Het
Cdhr5	C	T	7: 141,272,659	R348H	probably damaging	Het
Cenpj	A	G	14: 56,552,652	S647P	probably benign	Het
Chordc1	T	A	9: 18,295,351		probably null	Het
Chordc1	T	C	9: 18,301,012	S41P	probably damaging	Het
Ckm	T	C	7: 19,415,053		probably null	Het
Clca1	A	C	3: 145,005,966	I756S	probably damaging	Het
Clcn1	T	C	6: 42,291,389	V165A	possibly damaging	Het
Clec4a4	T	A	6: 122,991,745		probably null	Het
Cog7	T	C	7: 121,977,314	K130E	probably damaging	Het
Coq7	A	G	7: 118,510,048	I259T	unknown	Het
Cp	T	C	3: 19,974,966	S536P	probably damaging	Het
Cyp2d10	T	A	15: 82,404,246		probably null	Het
Dcst2	A	G	3: 89,366,300	I162V	probably benign	Het
Dennd4c	A	G	4: 86,802,991	E630G	probably damaging	Het
Dpt	A	T	1: 164,796,915	I62F	probably benign	Het
Ednrb	T	A	14: 103,843,008	I157F	probably damaging	Het
Ext1	A	T	15: 53,345,162	W68R	probably benign	Het
Fgf4	A	G	7: 144,862,786	K152E	probably benign	Het
G530012D18Rik	A	T	1: 85,577,143	T90S	unknown	Het
Galnt17	T	C	5: 130,964,111	T322A	possibly damaging	Het
Gcm1	A	T	9: 78,059,643	D48V	possibly damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gm49358	G	T	10: 86,825,207	R353L	probably damaging	Het
Golga4	A	G	9: 118,536,840	E320G	possibly damaging	Het
Herc3	T	C	6: 58,918,773	I1002T	probably damaging	Het
Hip1r	T	A	5: 123,973,782	V7E	possibly damaging	Het
Hipk1	G	A	3: 103,777,610	Q230*	probably null	Het
Igsf9b	C	T	9: 27,331,696	P726L	probably damaging	Het
Itgb6	T	C	2: 60,634,654	I345V	probably damaging	Het
Lhx4	G	T	1: 155,724,953	Q29K	probably benign	Het
Manba	A	G	3: 135,567,635	T777A	probably benign	Het
Mcm3ap	A	G	10: 76,501,311	D1360G	probably benign	Het
Meltf	T	A	16: 31,890,814		probably null	Het
Mmp14	T	G	14: 54,435,879	D81E	probably damaging	Het
Naalad2	T	C	9: 18,364,041		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Olfr1354	A	T	10: 78,917,505	I222L	possibly damaging	Het
Olfr881	T	A	9: 37,992,957	M150K	possibly damaging	Het
Pacs2	A	G	12: 113,061,692	D488G	possibly damaging	Het
Psg23	A	G	7: 18,607,139	S397P	probably benign	Het
Rfpl4	C	A	7: 5,110,660	R174L	probably damaging	Het
Runx3	T	A	4: 135,152,779	I3N	probably damaging	Het
Scn5a	A	T	9: 119,543,385	N214K	possibly damaging	Het
Slc27a1	T	C	8: 71,584,448	I412T	probably damaging	Het
Sptbn4	T	G	7: 27,416,785	T530P	probably benign	Het
Tex15	A	T	8: 33,570,826	R95*	probably null	Het
Tex15	T	C	8: 33,572,995	S818P	probably damaging	Het
Tmod1	A	T	4: 46,093,951	K221*	probably null	Het
Tpm3	G	A	3: 90,091,054	D272N	probably benign	Het
Trpm6	T	C	19: 18,853,791	V1340A	probably benign	Het
Ugt2b5	A	T	5: 87,125,272	C512S	probably benign	Het
Vmn2r82	A	T	10: 79,379,434	E417V	probably benign	Het
Wfdc11	T	C	2: 164,664,446	N60S	probably benign	Het
Zfp217	A	T	2: 170,114,152	S975R	probably benign	Het
Zfr	C	T	15: 12,146,223	Q287*	probably null	Het

Other mutations in Bap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Bap1	APN	14	31253569	missense	probably damaging	0.97
IGL02110:Bap1	APN	14	31257414	missense	probably damaging	0.97
IGL02740:Bap1	APN	14	31256772	missense	possibly damaging	0.94
IGL02937:Bap1	APN	14	31258327	missense	probably benign	0.07
R0138:Bap1	UTSW	14	31256724	missense	probably damaging	1.00
R1221:Bap1	UTSW	14	31257651	missense	probably damaging	1.00
R2131:Bap1	UTSW	14	31258331	nonsense	probably null
R2204:Bap1	UTSW	14	31256701	missense	probably benign	0.10
R3781:Bap1	UTSW	14	31257618	missense	possibly damaging	0.71
R4882:Bap1	UTSW	14	31251721	unclassified	probably benign
R4897:Bap1	UTSW	14	31258445	unclassified	probably benign
R5249:Bap1	UTSW	14	31257286	unclassified	probably benign
R6548:Bap1	UTSW	14	31256225	missense	probably benign	0.01
R6990:Bap1	UTSW	14	31255651	missense	probably benign
R7203:Bap1	UTSW	14	31254169	missense	probably damaging	1.00
R7414:Bap1	UTSW	14	31253615	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCTCGTCGTGTGATGATGAC -3'
(R):5'- TCTGCTGCGAGAACTCAAG -3'

Sequencing Primer
(F):5'- CGTGTGATGATGACGTTGTAC -3'
(R):5'- TGCGAGAACTCAAGGACCAAC -3'

Posted On

2019-06-26