Incidental Mutation 'R7212:Meltf'
ID 561178
Institutional Source Beutler Lab
Gene Symbol Meltf
Ensembl Gene ENSMUSG00000022780
Gene Name melanotransferrin
Synonyms MTf, CD228, melanotransferrin, Mfi2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7212 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 31878810-31899020 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 31890814 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023464]
AlphaFold Q9R0R1
Predicted Effect probably null
Transcript: ENSMUST00000023464
SMART Domains Protein: ENSMUSP00000023464
Gene: ENSMUSG00000022780

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 23 364 2.62e-183 SMART
TR_FER 366 719 4.23e-178 SMART
low complexity region 721 734 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, exhibit no physical defects, and develop normally with no detectable alterations in iron metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,161,672 A193V probably benign Het
4932438A13Rik C A 3: 37,048,009 N1363K Het
Aatf C T 11: 84,449,180 R435Q probably damaging Het
Abca13 A G 11: 9,298,854 H2867R probably benign Het
Abcd2 C T 15: 91,159,123 A621T possibly damaging Het
Actl11 T A 9: 107,928,657 S60T probably damaging Het
Adam28 T A 14: 68,637,397 N277I probably damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Arhgap27 C T 11: 103,360,755 R49Q probably damaging Het
Arhgap8 T G 15: 84,745,792 L108R probably null Het
Armc10 T C 5: 21,660,583 S209P probably damaging Het
Atp6v0a1 T C 11: 101,043,957 F617L probably benign Het
Bap1 T A 14: 31,251,623 N2K probably damaging Het
Cass4 T A 2: 172,427,186 L396* probably null Het
Ccdc40 A G 11: 119,264,444 Q1170R probably damaging Het
Cdhr5 C T 7: 141,272,659 R348H probably damaging Het
Cenpj A G 14: 56,552,652 S647P probably benign Het
Chordc1 T A 9: 18,295,351 probably null Het
Chordc1 T C 9: 18,301,012 S41P probably damaging Het
Ckm T C 7: 19,415,053 probably null Het
Clca1 A C 3: 145,005,966 I756S probably damaging Het
Clcn1 T C 6: 42,291,389 V165A possibly damaging Het
Clec4a4 T A 6: 122,991,745 probably null Het
Cog7 T C 7: 121,977,314 K130E probably damaging Het
Coq7 A G 7: 118,510,048 I259T unknown Het
Cp T C 3: 19,974,966 S536P probably damaging Het
Cyp2d10 T A 15: 82,404,246 probably null Het
Dcst2 A G 3: 89,366,300 I162V probably benign Het
Dennd4c A G 4: 86,802,991 E630G probably damaging Het
Dpt A T 1: 164,796,915 I62F probably benign Het
Ednrb T A 14: 103,843,008 I157F probably damaging Het
Ext1 A T 15: 53,345,162 W68R probably benign Het
Fgf4 A G 7: 144,862,786 K152E probably benign Het
G530012D18Rik A T 1: 85,577,143 T90S unknown Het
Galnt17 T C 5: 130,964,111 T322A possibly damaging Het
Gcm1 A T 9: 78,059,643 D48V possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm49358 G T 10: 86,825,207 R353L probably damaging Het
Golga4 A G 9: 118,536,840 E320G possibly damaging Het
Herc3 T C 6: 58,918,773 I1002T probably damaging Het
Hip1r T A 5: 123,973,782 V7E possibly damaging Het
Hipk1 G A 3: 103,777,610 Q230* probably null Het
Igsf9b C T 9: 27,331,696 P726L probably damaging Het
Itgb6 T C 2: 60,634,654 I345V probably damaging Het
Lhx4 G T 1: 155,724,953 Q29K probably benign Het
Manba A G 3: 135,567,635 T777A probably benign Het
Mcm3ap A G 10: 76,501,311 D1360G probably benign Het
Mmp14 T G 14: 54,435,879 D81E probably damaging Het
Naalad2 T C 9: 18,364,041 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1354 A T 10: 78,917,505 I222L possibly damaging Het
Olfr881 T A 9: 37,992,957 M150K possibly damaging Het
Pacs2 A G 12: 113,061,692 D488G possibly damaging Het
Psg23 A G 7: 18,607,139 S397P probably benign Het
Rfpl4 C A 7: 5,110,660 R174L probably damaging Het
Runx3 T A 4: 135,152,779 I3N probably damaging Het
Scn5a A T 9: 119,543,385 N214K possibly damaging Het
Slc27a1 T C 8: 71,584,448 I412T probably damaging Het
Sptbn4 T G 7: 27,416,785 T530P probably benign Het
Tex15 A T 8: 33,570,826 R95* probably null Het
Tex15 T C 8: 33,572,995 S818P probably damaging Het
Tmod1 A T 4: 46,093,951 K221* probably null Het
Tpm3 G A 3: 90,091,054 D272N probably benign Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Ugt2b5 A T 5: 87,125,272 C512S probably benign Het
Vmn2r82 A T 10: 79,379,434 E417V probably benign Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Zfp217 A T 2: 170,114,152 S975R probably benign Het
Zfr C T 15: 12,146,223 Q287* probably null Het
Other mutations in Meltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Meltf APN 16 31888985 missense probably damaging 1.00
IGL02942:Meltf APN 16 31890778 nonsense probably null
IGL03340:Meltf APN 16 31892784 missense probably damaging 1.00
R0734:Meltf UTSW 16 31881958 missense probably damaging 0.99
R1023:Meltf UTSW 16 31884960 missense probably damaging 1.00
R1751:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1767:Meltf UTSW 16 31883929 missense probably damaging 1.00
R1851:Meltf UTSW 16 31896577 missense probably benign 0.00
R1900:Meltf UTSW 16 31881969 critical splice donor site probably null
R1993:Meltf UTSW 16 31892622 nonsense probably null
R3423:Meltf UTSW 16 31896525 nonsense probably null
R3425:Meltf UTSW 16 31896525 nonsense probably null
R3804:Meltf UTSW 16 31884998 missense probably benign 0.23
R4724:Meltf UTSW 16 31892505 missense probably benign 0.03
R4976:Meltf UTSW 16 31894714 missense probably benign 0.01
R5007:Meltf UTSW 16 31887562 missense possibly damaging 0.60
R5058:Meltf UTSW 16 31887603 splice site probably null
R5534:Meltf UTSW 16 31890814 critical splice donor site probably null
R5661:Meltf UTSW 16 31881926 missense possibly damaging 0.65
R6028:Meltf UTSW 16 31887476 missense possibly damaging 0.91
R6424:Meltf UTSW 16 31880262 nonsense probably null
R6464:Meltf UTSW 16 31890776 missense probably benign 0.19
R6479:Meltf UTSW 16 31881882 missense probably damaging 1.00
R6525:Meltf UTSW 16 31888899 nonsense probably null
R6629:Meltf UTSW 16 31885076 missense probably damaging 1.00
R6964:Meltf UTSW 16 31880162 missense probably benign 0.41
R7133:Meltf UTSW 16 31892799 missense probably damaging 1.00
R7169:Meltf UTSW 16 31880162 missense probably benign 0.41
R7198:Meltf UTSW 16 31883799 missense possibly damaging 0.61
R7246:Meltf UTSW 16 31894862 missense probably damaging 1.00
R7407:Meltf UTSW 16 31894735 missense probably damaging 1.00
R7424:Meltf UTSW 16 31884946 missense probably damaging 1.00
R7475:Meltf UTSW 16 31881938 missense probably benign 0.12
R7727:Meltf UTSW 16 31883794 missense probably damaging 0.99
R7764:Meltf UTSW 16 31880267 missense probably benign 0.01
R8840:Meltf UTSW 16 31897202 missense probably damaging 0.98
R8896:Meltf UTSW 16 31890704 splice site probably benign
R9214:Meltf UTSW 16 31878945 missense probably benign
R9563:Meltf UTSW 16 31885051 missense probably damaging 1.00
R9638:Meltf UTSW 16 31887591 missense possibly damaging 0.87
X0062:Meltf UTSW 16 31880200 missense probably damaging 1.00
Z1177:Meltf UTSW 16 31880234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGAGCTAACTCTTTTCCC -3'
(R):5'- TGACCCTGTCCAGAAAGTCTGTAG -3'

Sequencing Primer
(F):5'- ATTCCTGCCTTCCAGAAG -3'
(R):5'- GATGTTTAGAGGTACGCATCACAC -3'
Posted On 2019-06-26