Incidental Mutation 'R7212:Trpm6'
ID561179
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7212 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18853791 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1340 (V1340A)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: V1340A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: V1340A

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik C T 6: 83,161,672 A193V probably benign Het
4932438A13Rik C A 3: 37,048,009 N1363K Het
Aatf C T 11: 84,449,180 R435Q probably damaging Het
Abca13 A G 11: 9,298,854 H2867R probably benign Het
Abcd2 C T 15: 91,159,123 A621T possibly damaging Het
Actl11 T A 9: 107,928,657 S60T probably damaging Het
Adam28 T A 14: 68,637,397 N277I probably damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Arhgap27 C T 11: 103,360,755 R49Q probably damaging Het
Arhgap8 T G 15: 84,745,792 L108R probably null Het
Armc10 T C 5: 21,660,583 S209P probably damaging Het
Atp6v0a1 T C 11: 101,043,957 F617L probably benign Het
Bap1 T A 14: 31,251,623 N2K probably damaging Het
Cass4 T A 2: 172,427,186 L396* probably null Het
Ccdc40 A G 11: 119,264,444 Q1170R probably damaging Het
Cdhr5 C T 7: 141,272,659 R348H probably damaging Het
Cenpj A G 14: 56,552,652 S647P probably benign Het
Chordc1 T A 9: 18,295,351 probably null Het
Chordc1 T C 9: 18,301,012 S41P probably damaging Het
Ckm T C 7: 19,415,053 probably null Het
Clca1 A C 3: 145,005,966 I756S probably damaging Het
Clcn1 T C 6: 42,291,389 V165A possibly damaging Het
Clec4a4 T A 6: 122,991,745 probably null Het
Cog7 T C 7: 121,977,314 K130E probably damaging Het
Coq7 A G 7: 118,510,048 I259T unknown Het
Cp T C 3: 19,974,966 S536P probably damaging Het
Cyp2d10 T A 15: 82,404,246 probably null Het
Dcst2 A G 3: 89,366,300 I162V probably benign Het
Dennd4c A G 4: 86,802,991 E630G probably damaging Het
Dpt A T 1: 164,796,915 I62F probably benign Het
Ednrb T A 14: 103,843,008 I157F probably damaging Het
Ext1 A T 15: 53,345,162 W68R probably benign Het
Fgf4 A G 7: 144,862,786 K152E probably benign Het
G530012D18Rik A T 1: 85,577,143 T90S unknown Het
Galnt17 T C 5: 130,964,111 T322A possibly damaging Het
Gcm1 A T 9: 78,059,643 D48V possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm49358 G T 10: 86,825,207 R353L probably damaging Het
Golga4 A G 9: 118,536,840 E320G possibly damaging Het
Herc3 T C 6: 58,918,773 I1002T probably damaging Het
Hip1r T A 5: 123,973,782 V7E possibly damaging Het
Hipk1 G A 3: 103,777,610 Q230* probably null Het
Igsf9b C T 9: 27,331,696 P726L probably damaging Het
Itgb6 T C 2: 60,634,654 I345V probably damaging Het
Lhx4 G T 1: 155,724,953 Q29K probably benign Het
Manba A G 3: 135,567,635 T777A probably benign Het
Mcm3ap A G 10: 76,501,311 D1360G probably benign Het
Meltf T A 16: 31,890,814 probably null Het
Mmp14 T G 14: 54,435,879 D81E probably damaging Het
Naalad2 T C 9: 18,364,041 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1354 A T 10: 78,917,505 I222L possibly damaging Het
Olfr881 T A 9: 37,992,957 M150K possibly damaging Het
Pacs2 A G 12: 113,061,692 D488G possibly damaging Het
Psg23 A G 7: 18,607,139 S397P probably benign Het
Rfpl4 C A 7: 5,110,660 R174L probably damaging Het
Runx3 T A 4: 135,152,779 I3N probably damaging Het
Scn5a A T 9: 119,543,385 N214K possibly damaging Het
Slc27a1 T C 8: 71,584,448 I412T probably damaging Het
Sptbn4 T G 7: 27,416,785 T530P probably benign Het
Tex15 A T 8: 33,570,826 R95* probably null Het
Tex15 T C 8: 33,572,995 S818P probably damaging Het
Tmod1 A T 4: 46,093,951 K221* probably null Het
Tpm3 G A 3: 90,091,054 D272N probably benign Het
Ugt2b5 A T 5: 87,125,272 C512S probably benign Het
Vmn2r82 A T 10: 79,379,434 E417V probably benign Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Zfp217 A T 2: 170,114,152 S975R probably benign Het
Zfr C T 15: 12,146,223 Q287* probably null Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18827408 missense probably benign 0.03
R7747:Trpm6 UTSW 19 18750045 splice site probably null
R7807:Trpm6 UTSW 19 18829856 missense probably benign 0.11
R7870:Trpm6 UTSW 19 18815241 missense probably benign 0.01
R7891:Trpm6 UTSW 19 18776710 missense probably benign 0.01
R7955:Trpm6 UTSW 19 18854290 missense probably benign 0.01
R7965:Trpm6 UTSW 19 18876110 missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18778659 missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18815350 missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18792862 missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18811790 missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18873861 missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18853968 missense probably benign 0.39
R8413:Trpm6 UTSW 19 18832485 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAATGTCATCTGTGCAAAGG -3'
(R):5'- CAAGTGGGTGGTGAGATCAC -3'

Sequencing Primer
(F):5'- CTGTGCAAAGGTTCTAAGTGAC -3'
(R):5'- CTTTGGTGTATATGCTCCAATACCAG -3'
Posted On2019-06-26