Incidental Mutation 'R7213:Slco6c1'
ID561184
Institutional Source Beutler Lab
Gene Symbol Slco6c1
Ensembl Gene ENSMUSG00000026331
Gene Namesolute carrier organic anion transporter family, member 6c1
Synonyms4933404A18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7213 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location97059038-97128301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97127946 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 77 (L77F)
Ref Sequence ENSEMBL: ENSMUSP00000027569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027569] [ENSMUST00000189547]
Predicted Effect probably benign
Transcript: ENSMUST00000027569
AA Change: L77F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027569
Gene: ENSMUSG00000026331
AA Change: L77F

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 95 654 3e-101 PFAM
Pfam:MFS_1 207 474 6.5e-14 PFAM
Pfam:Kazal_2 497 538 7.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189547
AA Change: L77F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140791
Gene: ENSMUSG00000026331
AA Change: L77F

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
Pfam:OATP 93 197 7.4e-12 PFAM
Pfam:MFS_1 99 457 2.2e-15 PFAM
Pfam:OATP 192 638 2.5e-64 PFAM
Pfam:Kazal_2 480 521 2.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G T 9: 124,293,900 Y131* probably null Het
2310009B15Rik A T 1: 138,853,629 V94D probably damaging Het
Actr1b T A 1: 36,702,140 N120I probably damaging Het
Adam17 A T 12: 21,336,678 Y452* probably null Het
Adam19 A T 11: 46,121,471 T265S probably benign Het
Adgrb1 A G 15: 74,569,884 T945A probably benign Het
BC067074 T A 13: 113,317,941 F174I Het
Bpifa5 G A 2: 154,165,983 V182M possibly damaging Het
Celsr3 C T 9: 108,849,040 T3156I probably damaging Het
Cntrl A G 2: 35,135,680 M674V possibly damaging Het
Cry2 C T 2: 92,413,659 V390I probably benign Het
Cwc25 G T 11: 97,754,029 Q168K probably benign Het
Dcbld2 C T 16: 58,450,763 A301V probably benign Het
Dclre1a T C 19: 56,529,635 Y1004C probably damaging Het
Ddhd1 A C 14: 45,657,753 S87A probably benign Het
Ear1 A G 14: 43,819,154 C86R probably damaging Het
Epha5 T C 5: 84,233,923 probably null Het
Fat2 A T 11: 55,281,045 Y2947* probably null Het
Fat4 G A 3: 38,999,087 V4077M possibly damaging Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fbxo16 A G 14: 65,299,419 probably null Het
Fto A T 8: 91,391,507 Q29L probably benign Het
Gk5 C T 9: 96,145,712 T200M probably damaging Het
Gm5916 C T 9: 36,128,650 G14E possibly damaging Het
Gm9972 A T 11: 43,036,408 probably benign Het
Gpr139 T A 7: 119,145,099 M88L probably benign Het
Gpr26 T C 7: 131,967,490 L188P probably damaging Het
Hbp1 A T 12: 31,937,197 S219T probably benign Het
Hist1h2ab G T 13: 23,751,163 A11S unknown Het
Hr A T 14: 70,558,350 E445V probably damaging Het
Il12rb1 A G 8: 70,816,453 K426E probably benign Het
Itgbl1 G A 14: 123,973,297 C469Y probably damaging Het
Kdm2b A T 5: 122,921,469 N523K probably damaging Het
Kptn A G 7: 16,120,779 N125S possibly damaging Het
Krt17 T C 11: 100,258,530 N238S probably benign Het
Lemd3 G A 10: 120,978,240 R363* probably null Het
Mmrn1 G A 6: 60,944,543 probably benign Het
Mtus1 T C 8: 41,084,487 D64G probably damaging Het
Muc16 A G 9: 18,641,416 V4527A probably benign Het
Naip2 T A 13: 100,187,483 D193V probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nf1 A G 11: 79,469,819 H1462R probably benign Het
Olfr133 T C 17: 38,149,074 V162A probably benign Het
Olfr988 A T 2: 85,353,556 Y123* probably null Het
Pappa2 T A 1: 158,936,886 T352S possibly damaging Het
Pcnt A G 10: 76,408,904 L1114P probably damaging Het
Pde6b T C 5: 108,404,090 Y212H probably damaging Het
Pik3c2g A T 6: 139,860,264 I604F Het
Pld2 A G 11: 70,553,372 D498G probably benign Het
Prag1 A T 8: 36,146,615 Q1107L probably damaging Het
Pwp1 A T 10: 85,876,309 I110F probably benign Het
Rims4 C T 2: 163,864,061 V218I probably benign Het
Rnf10 C T 5: 115,242,473 S754N probably damaging Het
Rnf10 T C 5: 115,242,474 S754G probably damaging Het
Sel1l2 A T 2: 140,244,135 V512E probably damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Sipa1 T C 19: 5,660,523 D153G probably damaging Het
Slc46a2 C T 4: 59,914,279 V215I possibly damaging Het
Smarca2 T C 19: 26,647,131 L397P possibly damaging Het
Spg7 C T 8: 123,090,232 A554V probably damaging Het
Stab1 T A 14: 31,143,673 M1753L probably benign Het
Stk11 A G 10: 80,116,618 M1V probably null Het
Supt6 C A 11: 78,232,150 G136C probably damaging Het
Svil G T 18: 5,094,574 R1418L probably damaging Het
Tfg A G 16: 56,701,153 S167P probably benign Het
Timeless T C 10: 128,243,289 V335A probably benign Het
Tll2 C A 19: 41,120,227 R328L probably damaging Het
Tomm7 T C 5: 23,844,061 S5G possibly damaging Het
Ttc39c G A 18: 12,687,081 probably null Het
Ttn T C 2: 76,725,761 E30300G probably benign Het
Tuba4a A T 1: 75,215,697 D452E possibly damaging Het
Tubgcp2 T C 7: 140,008,014 I233V probably benign Het
Tubgcp5 T A 7: 55,806,112 V296E probably damaging Het
Vmn2r53 T C 7: 12,601,056 S226G probably benign Het
Xrcc6 T C 15: 82,016,826 probably benign Het
Zfhx4 C A 3: 5,396,644 D1192E probably benign Het
Zfp180 G T 7: 24,104,513 W119L possibly damaging Het
Zfp3 A G 11: 70,772,525 I437V probably benign Het
Zfp616 A T 11: 74,085,863 Q986L probably benign Het
Zfp937 T A 2: 150,239,465 C472S probably damaging Het
Other mutations in Slco6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Slco6c1 APN 1 97087949 missense probably benign 0.00
IGL00571:Slco6c1 APN 1 97087951 missense probably benign 0.04
IGL01483:Slco6c1 APN 1 97128107 missense probably benign
IGL01543:Slco6c1 APN 1 97125828 missense possibly damaging 0.95
IGL01860:Slco6c1 APN 1 97075823 splice site probably benign
IGL03106:Slco6c1 APN 1 97066023 splice site probably benign
R0087:Slco6c1 UTSW 1 97118578 missense probably benign 0.00
R0543:Slco6c1 UTSW 1 97127898 missense probably damaging 0.99
R0674:Slco6c1 UTSW 1 97104773 splice site probably benign
R0826:Slco6c1 UTSW 1 97128101 missense probably benign 0.00
R0928:Slco6c1 UTSW 1 97104848 missense possibly damaging 0.88
R0969:Slco6c1 UTSW 1 97119960 missense probably benign 0.05
R1366:Slco6c1 UTSW 1 97128203 start gained probably null
R1559:Slco6c1 UTSW 1 97098498 missense probably damaging 1.00
R1594:Slco6c1 UTSW 1 97062438 missense probably benign 0.36
R1901:Slco6c1 UTSW 1 97072982 missense probably damaging 0.98
R2005:Slco6c1 UTSW 1 97081489 missense probably damaging 0.99
R2101:Slco6c1 UTSW 1 97072870 nonsense probably null
R2102:Slco6c1 UTSW 1 97127931 missense probably benign 0.02
R2120:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R2135:Slco6c1 UTSW 1 97104817 missense probably benign 0.01
R2295:Slco6c1 UTSW 1 97125748 missense probably damaging 1.00
R2437:Slco6c1 UTSW 1 97062476 missense probably benign 0.22
R4004:Slco6c1 UTSW 1 97075885 missense probably damaging 1.00
R4133:Slco6c1 UTSW 1 97081493 missense probably benign 0.02
R4643:Slco6c1 UTSW 1 97062424 missense probably benign 0.00
R4786:Slco6c1 UTSW 1 97087995 missense probably benign 0.04
R4942:Slco6c1 UTSW 1 97081324 missense probably damaging 1.00
R5485:Slco6c1 UTSW 1 97125756 missense probably damaging 1.00
R5573:Slco6c1 UTSW 1 97127931 missense probably benign 0.00
R5810:Slco6c1 UTSW 1 97075873 missense probably damaging 1.00
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6033:Slco6c1 UTSW 1 97081316 splice site probably null
R6191:Slco6c1 UTSW 1 97066083 missense possibly damaging 0.57
R6197:Slco6c1 UTSW 1 97072793 critical splice donor site probably null
R6286:Slco6c1 UTSW 1 97125720 missense possibly damaging 0.90
R6404:Slco6c1 UTSW 1 97118605 missense probably damaging 1.00
R6430:Slco6c1 UTSW 1 97075974 missense probably benign 0.43
R6492:Slco6c1 UTSW 1 97125813 missense probably damaging 0.99
R6649:Slco6c1 UTSW 1 97125711 missense probably benign 0.44
R6940:Slco6c1 UTSW 1 97072901 missense possibly damaging 0.80
R7138:Slco6c1 UTSW 1 97119981 missense possibly damaging 0.95
R7234:Slco6c1 UTSW 1 97125741 missense probably benign 0.06
R7320:Slco6c1 UTSW 1 97128162 missense possibly damaging 0.83
R7375:Slco6c1 UTSW 1 97081421 missense possibly damaging 0.58
R7383:Slco6c1 UTSW 1 97075883 nonsense probably null
R7422:Slco6c1 UTSW 1 97081482 missense probably benign 0.17
R7491:Slco6c1 UTSW 1 97127854 missense probably benign 0.32
R7561:Slco6c1 UTSW 1 97072966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACATGTTCGGGAAAATATGTC -3'
(R):5'- ATAAGCCATGGCCCATGTCC -3'

Sequencing Primer
(F):5'- CGGGAAAATATGTCTACTTCCACTG -3'
(R):5'- TGTCCGCAATAAAAAGTCAGATGAC -3'
Posted On2019-06-26