Mutagenetix > Incidental Mutations

Incidental Mutation 'R7213:Muc16'

561218

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.140) question?

Stock #

R7213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18641416 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 4527 (V4527A)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

probably benign
Transcript: ENSMUST00000208663
AA Change: V4527A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (80/81)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	G	T	9: 124,293,900	Y131*	probably null	Het
2310009B15Rik	A	T	1: 138,853,629	V94D	probably damaging	Het
Actr1b	T	A	1: 36,702,140	N120I	probably damaging	Het
Adam17	A	T	12: 21,336,678	Y452*	probably null	Het
Adam19	A	T	11: 46,121,471	T265S	probably benign	Het
Adgrb1	A	G	15: 74,569,884	T945A	probably benign	Het
BC067074	T	A	13: 113,317,941	F174I		Het
Bpifa5	G	A	2: 154,165,983	V182M	possibly damaging	Het
Celsr3	C	T	9: 108,849,040	T3156I	probably damaging	Het
Cntrl	A	G	2: 35,135,680	M674V	possibly damaging	Het
Cry2	C	T	2: 92,413,659	V390I	probably benign	Het
Cwc25	G	T	11: 97,754,029	Q168K	probably benign	Het
Dcbld2	C	T	16: 58,450,763	A301V	probably benign	Het
Dclre1a	T	C	19: 56,529,635	Y1004C	probably damaging	Het
Ddhd1	A	C	14: 45,657,753	S87A	probably benign	Het
Ear1	A	G	14: 43,819,154	C86R	probably damaging	Het
Epha5	T	C	5: 84,233,923		probably null	Het
Fat2	A	T	11: 55,281,045	Y2947*	probably null	Het
Fat4	G	A	3: 38,999,087	V4077M	possibly damaging	Het
Fbxl12	A	T	9: 20,639,008	V140E	probably damaging	Het
Fbxo16	A	G	14: 65,299,419		probably null	Het
Fto	A	T	8: 91,391,507	Q29L	probably benign	Het
Gk5	C	T	9: 96,145,712	T200M	probably damaging	Het
Gm5916	C	T	9: 36,128,650	G14E	possibly damaging	Het
Gm9972	A	T	11: 43,036,408		probably benign	Het
Gpr139	T	A	7: 119,145,099	M88L	probably benign	Het
Gpr26	T	C	7: 131,967,490	L188P	probably damaging	Het
Hbp1	A	T	12: 31,937,197	S219T	probably benign	Het
Hist1h2ab	G	T	13: 23,751,163	A11S	unknown	Het
Hr	A	T	14: 70,558,350	E445V	probably damaging	Het
Il12rb1	A	G	8: 70,816,453	K426E	probably benign	Het
Itgbl1	G	A	14: 123,973,297	C469Y	probably damaging	Het
Kdm2b	A	T	5: 122,921,469	N523K	probably damaging	Het
Kptn	A	G	7: 16,120,779	N125S	possibly damaging	Het
Krt17	T	C	11: 100,258,530	N238S	probably benign	Het
Lemd3	G	A	10: 120,978,240	R363*	probably null	Het
Mmrn1	G	A	6: 60,944,543		probably benign	Het
Mtus1	T	C	8: 41,084,487	D64G	probably damaging	Het
Naip2	T	A	13: 100,187,483	D193V	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nf1	A	G	11: 79,469,819	H1462R	probably benign	Het
Olfr133	T	C	17: 38,149,074	V162A	probably benign	Het
Olfr988	A	T	2: 85,353,556	Y123*	probably null	Het
Pappa2	T	A	1: 158,936,886	T352S	possibly damaging	Het
Pcnt	A	G	10: 76,408,904	L1114P	probably damaging	Het
Pde6b	T	C	5: 108,404,090	Y212H	probably damaging	Het
Pik3c2g	A	T	6: 139,860,264	I604F		Het
Pld2	A	G	11: 70,553,372	D498G	probably benign	Het
Prag1	A	T	8: 36,146,615	Q1107L	probably damaging	Het
Pwp1	A	T	10: 85,876,309	I110F	probably benign	Het
Rims4	C	T	2: 163,864,061	V218I	probably benign	Het
Rnf10	C	T	5: 115,242,473	S754N	probably damaging	Het
Rnf10	T	C	5: 115,242,474	S754G	probably damaging	Het
Sel1l2	A	T	2: 140,244,135	V512E	probably damaging	Het
Shank2	T	A	7: 144,031,409	M49K	probably benign	Het
Sipa1	T	C	19: 5,660,523	D153G	probably damaging	Het
Slc46a2	C	T	4: 59,914,279	V215I	possibly damaging	Het
Slco6c1	G	A	1: 97,127,946	L77F	probably benign	Het
Smarca2	T	C	19: 26,647,131	L397P	possibly damaging	Het
Spg7	C	T	8: 123,090,232	A554V	probably damaging	Het
Stab1	T	A	14: 31,143,673	M1753L	probably benign	Het
Stk11	A	G	10: 80,116,618	M1V	probably null	Het
Supt6	C	A	11: 78,232,150	G136C	probably damaging	Het
Svil	G	T	18: 5,094,574	R1418L	probably damaging	Het
Tfg	A	G	16: 56,701,153	S167P	probably benign	Het
Timeless	T	C	10: 128,243,289	V335A	probably benign	Het
Tll2	C	A	19: 41,120,227	R328L	probably damaging	Het
Tomm7	T	C	5: 23,844,061	S5G	possibly damaging	Het
Ttc39c	G	A	18: 12,687,081		probably null	Het
Ttn	T	C	2: 76,725,761	E30300G	probably benign	Het
Tuba4a	A	T	1: 75,215,697	D452E	possibly damaging	Het
Tubgcp2	T	C	7: 140,008,014	I233V	probably benign	Het
Tubgcp5	T	A	7: 55,806,112	V296E	probably damaging	Het
Vmn2r53	T	C	7: 12,601,056	S226G	probably benign	Het
Xrcc6	T	C	15: 82,016,826		probably benign	Het
Zfhx4	C	A	3: 5,396,644	D1192E	probably benign	Het
Zfp180	G	T	7: 24,104,513	W119L	possibly damaging	Het
Zfp3	A	G	11: 70,772,525	I437V	probably benign	Het
Zfp616	A	T	11: 74,085,863	Q986L	probably benign	Het
Zfp937	T	A	2: 150,239,465	C472S	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCATGTGGTTGTAGATCCTGC -3'
(R):5'- TCTCCCGGGATAACAGTAGTG -3'

Sequencing Primer
(F):5'- CCTGCTTGATCTATGGAAATAACCTG -3'
(R):5'- CAATTCAGTGACTTAGGCACAG -3'

Posted On

2019-06-26