Mutagenetix > Incidental Mutations

Incidental Mutation 'R7213:Smarca2'

561257

Institutional Source

Beutler Lab

Gene Symbol

Smarca2

Ensembl Gene

ENSMUSG00000024921

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

Synonyms

Snf2l2, brm, 2610209L14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7213 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26605050-26778322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26647131 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 397 (L397P)

Ref Sequence

ENSEMBL: ENSMUSP00000135784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176769]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025862
AA Change: L397P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: L397P

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1501	3.13e-41	SMART
low complexity region	1502	1524	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1564	1576	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099537
AA Change: L397P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: L397P

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	7e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
PDB:2DAT\|A	1389	1410	1e-6	PDB
low complexity region	1480	1508	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176030
AA Change: L397P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: L397P

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1519	1.74e-39	SMART
low complexity region	1520	1542	N/A	INTRINSIC
low complexity region	1544	1558	N/A	INTRINSIC
low complexity region	1582	1594	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176769
AA Change: L397P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: L397P

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	908	4.18e-24	SMART
low complexity region	947	956	N/A	INTRINSIC
HELICc	1033	1117	3.84e-23	SMART
low complexity region	1175	1190	N/A	INTRINSIC
SnAC	1211	1279	7.29e-28	SMART
low complexity region	1286	1308	N/A	INTRINSIC
BROMO	1333	1443	3.13e-41	SMART
low complexity region	1444	1466	N/A	INTRINSIC
low complexity region	1468	1482	N/A	INTRINSIC
low complexity region	1506	1518	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	G	T	9: 124,293,900	Y131*	probably null	Het
2310009B15Rik	A	T	1: 138,853,629	V94D	probably damaging	Het
Actr1b	T	A	1: 36,702,140	N120I	probably damaging	Het
Adam17	A	T	12: 21,336,678	Y452*	probably null	Het
Adam19	A	T	11: 46,121,471	T265S	probably benign	Het
Adgrb1	A	G	15: 74,569,884	T945A	probably benign	Het
BC067074	T	A	13: 113,317,941	F174I		Het
Bpifa5	G	A	2: 154,165,983	V182M	possibly damaging	Het
Celsr3	C	T	9: 108,849,040	T3156I	probably damaging	Het
Cntrl	A	G	2: 35,135,680	M674V	possibly damaging	Het
Cry2	C	T	2: 92,413,659	V390I	probably benign	Het
Cwc25	G	T	11: 97,754,029	Q168K	probably benign	Het
Dcbld2	C	T	16: 58,450,763	A301V	probably benign	Het
Dclre1a	T	C	19: 56,529,635	Y1004C	probably damaging	Het
Ddhd1	A	C	14: 45,657,753	S87A	probably benign	Het
Ear1	A	G	14: 43,819,154	C86R	probably damaging	Het
Epha5	T	C	5: 84,233,923		probably null	Het
Fat2	A	T	11: 55,281,045	Y2947*	probably null	Het
Fat4	G	A	3: 38,999,087	V4077M	possibly damaging	Het
Fbxl12	A	T	9: 20,639,008	V140E	probably damaging	Het
Fbxo16	A	G	14: 65,299,419		probably null	Het
Fto	A	T	8: 91,391,507	Q29L	probably benign	Het
Gk5	C	T	9: 96,145,712	T200M	probably damaging	Het
Gm5916	C	T	9: 36,128,650	G14E	possibly damaging	Het
Gm9972	A	T	11: 43,036,408		probably benign	Het
Gpr139	T	A	7: 119,145,099	M88L	probably benign	Het
Gpr26	T	C	7: 131,967,490	L188P	probably damaging	Het
Hbp1	A	T	12: 31,937,197	S219T	probably benign	Het
Hist1h2ab	G	T	13: 23,751,163	A11S	unknown	Het
Hr	A	T	14: 70,558,350	E445V	probably damaging	Het
Il12rb1	A	G	8: 70,816,453	K426E	probably benign	Het
Itgbl1	G	A	14: 123,973,297	C469Y	probably damaging	Het
Kdm2b	A	T	5: 122,921,469	N523K	probably damaging	Het
Kptn	A	G	7: 16,120,779	N125S	possibly damaging	Het
Krt17	T	C	11: 100,258,530	N238S	probably benign	Het
Lemd3	G	A	10: 120,978,240	R363*	probably null	Het
Mmrn1	G	A	6: 60,944,543		probably benign	Het
Mtus1	T	C	8: 41,084,487	D64G	probably damaging	Het
Muc16	A	G	9: 18,641,416	V4527A	probably benign	Het
Naip2	T	A	13: 100,187,483	D193V	probably damaging	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nf1	A	G	11: 79,469,819	H1462R	probably benign	Het
Olfr133	T	C	17: 38,149,074	V162A	probably benign	Het
Olfr988	A	T	2: 85,353,556	Y123*	probably null	Het
Pappa2	T	A	1: 158,936,886	T352S	possibly damaging	Het
Pcnt	A	G	10: 76,408,904	L1114P	probably damaging	Het
Pde6b	T	C	5: 108,404,090	Y212H	probably damaging	Het
Pik3c2g	A	T	6: 139,860,264	I604F		Het
Pld2	A	G	11: 70,553,372	D498G	probably benign	Het
Prag1	A	T	8: 36,146,615	Q1107L	probably damaging	Het
Pwp1	A	T	10: 85,876,309	I110F	probably benign	Het
Rims4	C	T	2: 163,864,061	V218I	probably benign	Het
Rnf10	C	T	5: 115,242,473	S754N	probably damaging	Het
Rnf10	T	C	5: 115,242,474	S754G	probably damaging	Het
Sel1l2	A	T	2: 140,244,135	V512E	probably damaging	Het
Shank2	T	A	7: 144,031,409	M49K	probably benign	Het
Sipa1	T	C	19: 5,660,523	D153G	probably damaging	Het
Slc46a2	C	T	4: 59,914,279	V215I	possibly damaging	Het
Slco6c1	G	A	1: 97,127,946	L77F	probably benign	Het
Spg7	C	T	8: 123,090,232	A554V	probably damaging	Het
Stab1	T	A	14: 31,143,673	M1753L	probably benign	Het
Stk11	A	G	10: 80,116,618	M1V	probably null	Het
Supt6	C	A	11: 78,232,150	G136C	probably damaging	Het
Svil	G	T	18: 5,094,574	R1418L	probably damaging	Het
Tfg	A	G	16: 56,701,153	S167P	probably benign	Het
Timeless	T	C	10: 128,243,289	V335A	probably benign	Het
Tll2	C	A	19: 41,120,227	R328L	probably damaging	Het
Tomm7	T	C	5: 23,844,061	S5G	possibly damaging	Het
Ttc39c	G	A	18: 12,687,081		probably null	Het
Ttn	T	C	2: 76,725,761	E30300G	probably benign	Het
Tuba4a	A	T	1: 75,215,697	D452E	possibly damaging	Het
Tubgcp2	T	C	7: 140,008,014	I233V	probably benign	Het
Tubgcp5	T	A	7: 55,806,112	V296E	probably damaging	Het
Vmn2r53	T	C	7: 12,601,056	S226G	probably benign	Het
Xrcc6	T	C	15: 82,016,826		probably benign	Het
Zfhx4	C	A	3: 5,396,644	D1192E	probably benign	Het
Zfp180	G	T	7: 24,104,513	W119L	possibly damaging	Het
Zfp3	A	G	11: 70,772,525	I437V	probably benign	Het
Zfp616	A	T	11: 74,085,863	Q986L	probably benign	Het
Zfp937	T	A	2: 150,239,465	C472S	probably damaging	Het

Other mutations in Smarca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01368:Smarca2	APN	19	26774294	missense	possibly damaging	0.82
IGL01907:Smarca2	APN	19	26698465	missense	possibly damaging	0.59
IGL02039:Smarca2	APN	19	26716137	missense	probably damaging	1.00
IGL02110:Smarca2	APN	19	26672740	missense	possibly damaging	0.96
IGL02561:Smarca2	APN	19	26716182	missense	possibly damaging	0.92
IGL02649:Smarca2	APN	19	26640586	missense	possibly damaging	0.73
IGL02880:Smarca2	APN	19	26676624	splice site	probably benign
IGL03028:Smarca2	APN	19	26678312	splice site	probably benign
IGL03187:Smarca2	APN	19	26672824	missense	probably damaging	0.98
IGL03213:Smarca2	APN	19	26623975	missense	probably damaging	1.00
IGL03354:Smarca2	APN	19	26619903	missense	probably benign	0.01
FR4737:Smarca2	UTSW	19	26630999	unclassified	probably benign
PIT1430001:Smarca2	UTSW	19	26649093	missense	probably benign	0.35
R0184:Smarca2	UTSW	19	26692249	nonsense	probably null
R0306:Smarca2	UTSW	19	26640613	missense	probably damaging	1.00
R0538:Smarca2	UTSW	19	26691362	missense	probably damaging	0.99
R0565:Smarca2	UTSW	19	26681875	missense	possibly damaging	0.71
R0610:Smarca2	UTSW	19	26691391	missense	probably damaging	1.00
R0669:Smarca2	UTSW	19	26706200	missense	possibly damaging	0.51
R0726:Smarca2	UTSW	19	26698403	missense	probably damaging	1.00
R1184:Smarca2	UTSW	19	26770933	splice site	probably benign
R1256:Smarca2	UTSW	19	26681973	missense	probably benign	0.06
R1299:Smarca2	UTSW	19	26771611	critical splice donor site	probably null
R1306:Smarca2	UTSW	19	26770988	missense	possibly damaging	0.81
R1381:Smarca2	UTSW	19	26630828	missense	probably damaging	1.00
R1400:Smarca2	UTSW	19	26676740	missense	probably damaging	0.98
R1415:Smarca2	UTSW	19	26710684	missense	probably null	0.72
R1496:Smarca2	UTSW	19	26631101	missense	possibly damaging	0.85
R1582:Smarca2	UTSW	19	26751905	missense	probably damaging	0.99
R1666:Smarca2	UTSW	19	26647034	missense	possibly damaging	0.65
R1668:Smarca2	UTSW	19	26647034	missense	possibly damaging	0.65
R1751:Smarca2	UTSW	19	26640380	splice site	probably benign
R1861:Smarca2	UTSW	19	26623884	missense	probably benign	0.03
R1962:Smarca2	UTSW	19	26672724	nonsense	probably null
R1964:Smarca2	UTSW	19	26672724	nonsense	probably null
R1998:Smarca2	UTSW	19	26631093	missense	probably benign	0.33
R2014:Smarca2	UTSW	19	26683905	missense	possibly damaging	0.86
R2255:Smarca2	UTSW	19	26771038	missense	probably benign	0.01
R2392:Smarca2	UTSW	19	26640650	critical splice donor site	probably null
R2439:Smarca2	UTSW	19	26691454	critical splice donor site	probably null
R3030:Smarca2	UTSW	19	26752029	missense	possibly damaging	0.84
R3195:Smarca2	UTSW	19	26683822	missense	possibly damaging	0.85
R3430:Smarca2	UTSW	19	26691349	missense	probably damaging	1.00
R3710:Smarca2	UTSW	19	26668890	unclassified	probably benign
R3845:Smarca2	UTSW	19	26720873	missense	probably benign	0.06
R4013:Smarca2	UTSW	19	26683927	splice site	probably null
R4014:Smarca2	UTSW	19	26683927	splice site	probably null
R4016:Smarca2	UTSW	19	26683927	splice site	probably null
R4271:Smarca2	UTSW	19	26720949	critical splice donor site	probably null
R4471:Smarca2	UTSW	19	26619877	missense	possibly damaging	0.86
R4612:Smarca2	UTSW	19	26776225	missense	possibly damaging	0.70
R4730:Smarca2	UTSW	19	26630673	missense	probably damaging	1.00
R4755:Smarca2	UTSW	19	26654483	missense	possibly damaging	0.86
R4999:Smarca2	UTSW	19	26720855	nonsense	probably null
R5015:Smarca2	UTSW	19	26691388	missense	possibly damaging	0.86
R5320:Smarca2	UTSW	19	26691372	missense	probably damaging	1.00
R5393:Smarca2	UTSW	19	26640429	missense	probably benign	0.18
R5503:Smarca2	UTSW	19	26623936	missense	probably damaging	0.96
R5503:Smarca2	UTSW	19	26682046	missense	possibly damaging	0.93
R5715:Smarca2	UTSW	19	26649122	missense	probably benign	0.16
R5790:Smarca2	UTSW	19	26676724	missense	probably damaging	1.00
R5874:Smarca2	UTSW	19	26776069	intron	probably benign
R6209:Smarca2	UTSW	19	26771004	nonsense	probably null
R6236:Smarca2	UTSW	19	26696213	missense	probably benign	0.33
R6291:Smarca2	UTSW	19	26630892	missense	probably damaging	1.00
R6292:Smarca2	UTSW	19	26630892	missense	probably damaging	1.00
R6325:Smarca2	UTSW	19	26678363	missense	probably damaging	0.99
R6544:Smarca2	UTSW	19	26630931	missense	probably damaging	1.00
R6572:Smarca2	UTSW	19	26679173	missense	possibly damaging	0.71
R6589:Smarca2	UTSW	19	26619884	missense	possibly damaging	0.53
R6601:Smarca2	UTSW	19	26654377	missense	probably benign	0.30
R6804:Smarca2	UTSW	19	26751886	missense	possibly damaging	0.93
R6922:Smarca2	UTSW	19	26691349	missense	probably damaging	1.00
R7047:Smarca2	UTSW	19	26669155	missense	possibly damaging	0.83
R7257:Smarca2	UTSW	19	26654464	nonsense	probably null
R7259:Smarca2	UTSW	19	26654464	nonsense	probably null
R7479:Smarca2	UTSW	19	26640487	missense	probably benign	0.00
R7512:Smarca2	UTSW	19	26683809	missense	possibly damaging	0.51
RF001:Smarca2	UTSW	19	26630986	unclassified	probably benign
RF001:Smarca2	UTSW	19	26631021	unclassified	probably benign
RF004:Smarca2	UTSW	19	26631020	unclassified	probably benign
RF019:Smarca2	UTSW	19	26631001	unclassified	probably benign
RF021:Smarca2	UTSW	19	26630997	unclassified	probably benign
RF024:Smarca2	UTSW	19	26631020	unclassified	probably benign
RF034:Smarca2	UTSW	19	26631011	unclassified	probably benign
RF040:Smarca2	UTSW	19	26631022	unclassified	probably benign
RF041:Smarca2	UTSW	19	26631021	unclassified	probably benign
RF047:Smarca2	UTSW	19	26631005	unclassified	probably benign
RF051:Smarca2	UTSW	19	26630988	unclassified	probably benign
X0061:Smarca2	UTSW	19	26720840	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCATAATGCAGGTCTCCACC -3'
(R):5'- CATGGTTTTCCTCCAGGGTAC -3'

Sequencing Primer
(F):5'- GCAGGTCTCCACCCACCC -3'
(R):5'- GAATAACGAGCGGTTCATACTC -3'

Posted On

2019-06-26