Incidental Mutation 'R7213:Dclre1a'
ID561259
Institutional Source Beutler Lab
Gene Symbol Dclre1a
Ensembl Gene ENSMUSG00000025077
Gene NameDNA cross-link repair 1A
Synonyms2810043H12Rik, SMN1a, SNM1, mSNM1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7213 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location56529167-56548222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56529635 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1004 (Y1004C)
Ref Sequence ENSEMBL: ENSMUSP00000138290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182276] [ENSMUST00000183143]
Predicted Effect probably damaging
Transcript: ENSMUST00000182276
AA Change: Y1004C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138290
Gene: ENSMUSG00000025077
AA Change: Y1004C

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
low complexity region 211 220 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
Lactamase_B 705 853 7.86e-1 SMART
Pfam:DRMBL 921 1027 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183143
SMART Domains Protein: ENSMUSP00000138537
Gene: ENSMUSG00000025077

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit increased sensitivity to the DNA interstrand cross-linking agent mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik G T 9: 124,293,900 Y131* probably null Het
2310009B15Rik A T 1: 138,853,629 V94D probably damaging Het
Actr1b T A 1: 36,702,140 N120I probably damaging Het
Adam17 A T 12: 21,336,678 Y452* probably null Het
Adam19 A T 11: 46,121,471 T265S probably benign Het
Adgrb1 A G 15: 74,569,884 T945A probably benign Het
BC067074 T A 13: 113,317,941 F174I Het
Bpifa5 G A 2: 154,165,983 V182M possibly damaging Het
Celsr3 C T 9: 108,849,040 T3156I probably damaging Het
Cntrl A G 2: 35,135,680 M674V possibly damaging Het
Cry2 C T 2: 92,413,659 V390I probably benign Het
Cwc25 G T 11: 97,754,029 Q168K probably benign Het
Dcbld2 C T 16: 58,450,763 A301V probably benign Het
Ddhd1 A C 14: 45,657,753 S87A probably benign Het
Ear1 A G 14: 43,819,154 C86R probably damaging Het
Epha5 T C 5: 84,233,923 probably null Het
Fat2 A T 11: 55,281,045 Y2947* probably null Het
Fat4 G A 3: 38,999,087 V4077M possibly damaging Het
Fbxl12 A T 9: 20,639,008 V140E probably damaging Het
Fbxo16 A G 14: 65,299,419 probably null Het
Fto A T 8: 91,391,507 Q29L probably benign Het
Gk5 C T 9: 96,145,712 T200M probably damaging Het
Gm5916 C T 9: 36,128,650 G14E possibly damaging Het
Gm9972 A T 11: 43,036,408 probably benign Het
Gpr139 T A 7: 119,145,099 M88L probably benign Het
Gpr26 T C 7: 131,967,490 L188P probably damaging Het
Hbp1 A T 12: 31,937,197 S219T probably benign Het
Hist1h2ab G T 13: 23,751,163 A11S unknown Het
Hr A T 14: 70,558,350 E445V probably damaging Het
Il12rb1 A G 8: 70,816,453 K426E probably benign Het
Itgbl1 G A 14: 123,973,297 C469Y probably damaging Het
Kdm2b A T 5: 122,921,469 N523K probably damaging Het
Kptn A G 7: 16,120,779 N125S possibly damaging Het
Krt17 T C 11: 100,258,530 N238S probably benign Het
Lemd3 G A 10: 120,978,240 R363* probably null Het
Mmrn1 G A 6: 60,944,543 probably benign Het
Mtus1 T C 8: 41,084,487 D64G probably damaging Het
Muc16 A G 9: 18,641,416 V4527A probably benign Het
Naip2 T A 13: 100,187,483 D193V probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nf1 A G 11: 79,469,819 H1462R probably benign Het
Olfr133 T C 17: 38,149,074 V162A probably benign Het
Olfr988 A T 2: 85,353,556 Y123* probably null Het
Pappa2 T A 1: 158,936,886 T352S possibly damaging Het
Pcnt A G 10: 76,408,904 L1114P probably damaging Het
Pde6b T C 5: 108,404,090 Y212H probably damaging Het
Pik3c2g A T 6: 139,860,264 I604F Het
Pld2 A G 11: 70,553,372 D498G probably benign Het
Prag1 A T 8: 36,146,615 Q1107L probably damaging Het
Pwp1 A T 10: 85,876,309 I110F probably benign Het
Rims4 C T 2: 163,864,061 V218I probably benign Het
Rnf10 C T 5: 115,242,473 S754N probably damaging Het
Rnf10 T C 5: 115,242,474 S754G probably damaging Het
Sel1l2 A T 2: 140,244,135 V512E probably damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Sipa1 T C 19: 5,660,523 D153G probably damaging Het
Slc46a2 C T 4: 59,914,279 V215I possibly damaging Het
Slco6c1 G A 1: 97,127,946 L77F probably benign Het
Smarca2 T C 19: 26,647,131 L397P possibly damaging Het
Spg7 C T 8: 123,090,232 A554V probably damaging Het
Stab1 T A 14: 31,143,673 M1753L probably benign Het
Stk11 A G 10: 80,116,618 M1V probably null Het
Supt6 C A 11: 78,232,150 G136C probably damaging Het
Svil G T 18: 5,094,574 R1418L probably damaging Het
Tfg A G 16: 56,701,153 S167P probably benign Het
Timeless T C 10: 128,243,289 V335A probably benign Het
Tll2 C A 19: 41,120,227 R328L probably damaging Het
Tomm7 T C 5: 23,844,061 S5G possibly damaging Het
Ttc39c G A 18: 12,687,081 probably null Het
Ttn T C 2: 76,725,761 E30300G probably benign Het
Tuba4a A T 1: 75,215,697 D452E possibly damaging Het
Tubgcp2 T C 7: 140,008,014 I233V probably benign Het
Tubgcp5 T A 7: 55,806,112 V296E probably damaging Het
Vmn2r53 T C 7: 12,601,056 S226G probably benign Het
Xrcc6 T C 15: 82,016,826 probably benign Het
Zfhx4 C A 3: 5,396,644 D1192E probably benign Het
Zfp180 G T 7: 24,104,513 W119L possibly damaging Het
Zfp3 A G 11: 70,772,525 I437V probably benign Het
Zfp616 A T 11: 74,085,863 Q986L probably benign Het
Zfp937 T A 2: 150,239,465 C472S probably damaging Het
Other mutations in Dclre1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Dclre1a APN 19 56547057 missense probably damaging 1.00
IGL02113:Dclre1a APN 19 56541532 missense probably damaging 0.98
IGL02264:Dclre1a APN 19 56544293 missense possibly damaging 0.93
IGL03303:Dclre1a APN 19 56546766 missense possibly damaging 0.85
Gof UTSW 19 56542709 missense probably damaging 1.00
Hoopla UTSW 19 56546635 critical splice donor site probably null
FR4589:Dclre1a UTSW 19 56544123 utr 3 prime probably benign
PIT4377001:Dclre1a UTSW 19 56544405 missense probably benign 0.05
R0081:Dclre1a UTSW 19 56542707 missense probably damaging 1.00
R0355:Dclre1a UTSW 19 56546635 critical splice donor site probably null
R0422:Dclre1a UTSW 19 56544135 nonsense probably null
R0486:Dclre1a UTSW 19 56541490 splice site probably benign
R0619:Dclre1a UTSW 19 56545409 missense probably benign 0.00
R0639:Dclre1a UTSW 19 56538440 missense probably damaging 1.00
R1221:Dclre1a UTSW 19 56531268 missense possibly damaging 0.69
R1352:Dclre1a UTSW 19 56545163 missense probably damaging 1.00
R1824:Dclre1a UTSW 19 56546718 unclassified probably null
R1833:Dclre1a UTSW 19 56541500 splice site probably null
R3851:Dclre1a UTSW 19 56541507 missense probably damaging 1.00
R3889:Dclre1a UTSW 19 56545320 missense probably benign 0.00
R4373:Dclre1a UTSW 19 56545442 missense probably benign 0.04
R5277:Dclre1a UTSW 19 56544732 missense possibly damaging 0.78
R5747:Dclre1a UTSW 19 56541532 missense probably damaging 0.98
R5792:Dclre1a UTSW 19 56529590 missense probably damaging 1.00
R5892:Dclre1a UTSW 19 56547140 missense probably benign 0.29
R5993:Dclre1a UTSW 19 56542737 missense probably damaging 1.00
R6368:Dclre1a UTSW 19 56546791 missense probably benign 0.02
R6706:Dclre1a UTSW 19 56545069 missense probably benign 0.11
R6944:Dclre1a UTSW 19 56545019 missense possibly damaging 0.90
R6960:Dclre1a UTSW 19 56542709 missense probably damaging 1.00
R7023:Dclre1a UTSW 19 56540206 missense probably damaging 0.99
R7355:Dclre1a UTSW 19 56547135 missense possibly damaging 0.53
R7413:Dclre1a UTSW 19 56542650 missense probably damaging 1.00
R7577:Dclre1a UTSW 19 56529533 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTACGGAACTCAGCAG -3'
(R):5'- AGGTATGCGCATTAAAACGTAG -3'

Sequencing Primer
(F):5'- GACGTCTGTGACAGCATCAGTATC -3'
(R):5'- GGTTTTTAGAAAATAACCTCTTCC -3'
Posted On2019-06-26