Incidental Mutation 'R0594:Fam129c'
ID56126
Institutional Source Beutler Lab
Gene Symbol Fam129c
Ensembl Gene ENSMUSG00000043243
Gene Namefamily with sequence similarity 129, member C
SynonymsBcnp1
MMRRC Submission 038784-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0594 (G1)
Quality Score112
Status Validated
Chromosome8
Chromosomal Location71597648-71607936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71599135 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 38 (A38E)
Ref Sequence ENSEMBL: ENSMUSP00000123432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034264] [ENSMUST00000127626] [ENSMUST00000143441] [ENSMUST00000143662]
Predicted Effect probably benign
Transcript: ENSMUST00000034264
SMART Domains Protein: ENSMUSP00000034264
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 18 217 2.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127285
Predicted Effect probably benign
Transcript: ENSMUST00000127626
SMART Domains Protein: ENSMUSP00000122042
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 18 214 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132891
Predicted Effect probably benign
Transcript: ENSMUST00000138742
SMART Domains Protein: ENSMUSP00000120113
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 7 174 7.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141594
Predicted Effect probably benign
Transcript: ENSMUST00000143441
SMART Domains Protein: ENSMUSP00000116524
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 12 134 3.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143662
AA Change: A38E

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123432
Gene: ENSMUSG00000043243
AA Change: A38E

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
PH 68 196 4.94e-4 SMART
low complexity region 218 230 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Meta Mutation Damage Score 0.2808 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 99% (119/120)
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,389,880 V41A probably benign Het
Acad11 A G 9: 104,095,563 Q367R probably benign Het
Ackr4 A G 9: 104,099,004 V248A possibly damaging Het
Adamts14 T C 10: 61,202,887 E945G probably damaging Het
Akap2 A G 4: 57,856,752 T694A probably benign Het
Ano2 A G 6: 125,982,765 M663V probably damaging Het
Apc2 T A 10: 80,306,256 C336* probably null Het
Arhgap17 A G 7: 123,294,518 S560P probably benign Het
Arl5a T C 2: 52,405,014 D128G probably damaging Het
Atp6v0a2 C A 5: 124,717,982 R678S probably benign Het
B4galnt2 C A 11: 95,891,909 A26S probably benign Het
C1qtnf1 A T 11: 118,446,628 T95S possibly damaging Het
Ccdc188 T A 16: 18,218,920 F241L probably benign Het
Cdh19 A T 1: 110,925,867 D281E probably benign Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cherp A T 8: 72,462,402 probably null Het
Cpne9 T A 6: 113,290,400 probably benign Het
Cthrc1 A T 15: 39,077,142 R47W possibly damaging Het
Dcaf13 A G 15: 39,123,268 E145G probably benign Het
Dcaf4 T A 12: 83,538,043 probably null Het
Dgka A C 10: 128,733,110 probably benign Het
Dhrs13 T A 11: 78,034,525 F157L probably damaging Het
Dnajb5 A T 4: 42,956,577 Y88F probably damaging Het
Dpp8 A G 9: 65,036,998 T16A probably damaging Het
Dscc1 A T 15: 55,089,052 I91K possibly damaging Het
Efemp2 T A 19: 5,475,063 probably benign Het
Elf2 T C 3: 51,256,453 T504A possibly damaging Het
Elk3 G A 10: 93,265,160 S243F probably damaging Het
Ell2 A G 13: 75,749,993 D93G probably damaging Het
Eln G T 5: 134,712,398 probably benign Het
Eme1 C T 11: 94,650,430 D189N possibly damaging Het
Epb41l2 A G 10: 25,443,770 E167G possibly damaging Het
Exoc5 A T 14: 49,036,087 probably benign Het
Fam170b A G 14: 32,836,314 K369E unknown Het
Fam187b T A 7: 30,977,154 C29* probably null Het
Fam20c T C 5: 138,766,637 S260P possibly damaging Het
Fam216b G A 14: 78,086,674 A21V possibly damaging Het
Fam98a A T 17: 75,538,487 Y421* probably null Het
Farp2 T C 1: 93,576,500 V333A probably damaging Het
Fcgr1 T C 3: 96,292,312 Y93C probably damaging Het
Fgd2 A T 17: 29,365,552 I157F probably damaging Het
Frmd4b T A 6: 97,325,426 probably benign Het
Fut9 T C 4: 25,620,526 D96G possibly damaging Het
Glt8d1 G A 14: 31,010,410 probably null Het
Gm7579 T A 7: 142,212,384 C176S unknown Het
Gmpr2 A G 14: 55,677,988 E272G probably damaging Het
Grin2b T C 6: 135,733,929 H873R probably damaging Het
Gtf2i C T 5: 134,242,173 probably benign Het
Htr3b A T 9: 48,947,631 V69E probably benign Het
Icam5 A G 9: 21,035,598 N474S probably benign Het
Itgal T A 7: 127,314,060 S610T probably damaging Het
Jag1 T A 2: 137,087,080 I819L probably damaging Het
Kif9 A T 9: 110,511,340 E467V probably benign Het
Krit1 T C 5: 3,823,694 L491P possibly damaging Het
Lipo2 T G 19: 33,746,902 I155L possibly damaging Het
Lmbr1 A G 5: 29,292,209 F65L possibly damaging Het
Lsp1 G A 7: 142,488,950 probably benign Het
Marc2 T C 1: 184,841,339 N121D probably benign Het
Mgat5 T A 1: 127,412,248 D455E probably damaging Het
Mical2 A T 7: 112,318,450 Y338F probably damaging Het
Mkl1 G A 15: 81,017,174 T372I probably damaging Het
Mre11a T G 9: 14,815,209 S396A probably benign Het
Myo3a C T 2: 22,544,332 probably benign Het
Naca T C 10: 128,040,355 probably benign Het
Nav1 A T 1: 135,467,643 I996K possibly damaging Het
Ncbp1 A G 4: 46,170,551 N742S probably benign Het
Ndufaf3 G A 9: 108,566,923 A2V probably benign Het
Ntn5 G T 7: 45,686,681 A47S probably damaging Het
Olfr1122 T A 2: 87,387,954 I83N probably damaging Het
Olfr13 T A 6: 43,174,607 V207E possibly damaging Het
Olfr1502 G T 19: 13,862,279 C162F probably benign Het
Olfr384 G A 11: 73,603,392 E271K probably benign Het
Olfr392 T C 11: 73,814,617 H155R probably benign Het
Olfr777 T C 10: 129,269,152 Y57C possibly damaging Het
Otud7a T A 7: 63,727,472 L203* probably null Het
Pcdhb13 A G 18: 37,443,931 Y454C probably damaging Het
Pdzph1 C T 17: 58,954,479 V853M possibly damaging Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Pm20d2 C T 4: 33,181,746 E286K probably damaging Het
Polr2i T A 7: 30,232,745 probably null Het
Ppp1r12b A G 1: 134,776,479 L879P probably damaging Het
Prf1 C A 10: 61,303,722 Y486* probably null Het
Qsox2 T G 2: 26,214,044 T325P probably damaging Het
Rab1b G T 19: 5,100,656 probably benign Het
Rbm19 T C 5: 120,128,316 probably null Het
Rhobtb2 A G 14: 69,793,948 V576A probably benign Het
Rnps1 G A 17: 24,424,437 V215M probably damaging Het
Rps11 A G 7: 45,124,282 probably benign Het
Serpinb3d C T 1: 107,079,347 M210I probably damaging Het
Sgsm1 T C 5: 113,310,562 T17A probably benign Het
Slc6a3 A G 13: 73,538,642 T43A probably damaging Het
Sox4 C G 13: 28,952,904 A40P probably damaging Het
Spry2 A T 14: 105,893,310 D147E possibly damaging Het
Stpg1 A G 4: 135,519,431 N157D possibly damaging Het
Sumf1 T C 6: 108,173,414 D152G probably benign Het
Tbr1 T C 2: 61,811,620 S410P possibly damaging Het
Tdrd6 A G 17: 43,629,383 V258A probably damaging Het
Tirap C T 9: 35,188,761 G209D probably damaging Het
Tnfrsf8 A T 4: 145,296,861 V134D probably damaging Het
Tnr A G 1: 159,850,335 T97A probably benign Het
Tspan32 T A 7: 143,015,610 F135L probably damaging Het
Ttn T C 2: 76,789,056 K16021E probably damaging Het
Tusc3 T A 8: 39,096,968 I251N probably damaging Het
Usp38 A T 8: 81,005,366 I305N probably damaging Het
Usp4 T A 9: 108,370,881 probably null Het
Usp5 A T 6: 124,817,424 D764E probably damaging Het
Vangl2 A T 1: 172,004,657 V544E probably damaging Het
Vldlr G A 19: 27,234,819 V78M probably damaging Het
Vmn1r29 T C 6: 58,307,772 V159A probably benign Het
Vmn2r16 T A 5: 109,363,896 F656L probably damaging Het
Wdfy3 T A 5: 101,906,185 I1590F possibly damaging Het
Xpo1 T A 11: 23,280,402 V263E probably damaging Het
Zbtb38 A G 9: 96,685,954 S1026P probably damaging Het
Zfp407 A T 18: 84,562,567 D140E possibly damaging Het
Zfp637 T A 6: 117,845,686 Y258* probably null Het
Zfp951 T A 5: 104,814,572 Q376L possibly damaging Het
Other mutations in Fam129c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Fam129c APN 8 71604863 splice site probably benign
IGL01530:Fam129c APN 8 71603917 splice site probably benign
IGL01553:Fam129c APN 8 71602902 missense possibly damaging 0.86
IGL02313:Fam129c APN 8 71602860 missense possibly damaging 0.92
IGL02341:Fam129c APN 8 71603799 missense possibly damaging 0.60
IGL02541:Fam129c APN 8 71602782 missense probably benign 0.07
IGL02745:Fam129c APN 8 71605038 splice site probably null
R0006:Fam129c UTSW 8 71605044 splice site probably benign
R0391:Fam129c UTSW 8 71602499 splice site probably benign
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1643:Fam129c UTSW 8 71600164 missense probably benign 0.34
R1848:Fam129c UTSW 8 71603769 missense possibly damaging 0.95
R1986:Fam129c UTSW 8 71603760 missense possibly damaging 0.63
R2319:Fam129c UTSW 8 71602764 missense probably benign 0.00
R4386:Fam129c UTSW 8 71607511 intron probably benign
R4564:Fam129c UTSW 8 71605060 intron probably benign
R4666:Fam129c UTSW 8 71603825 nonsense probably null
R6341:Fam129c UTSW 8 71600077 missense probably damaging 1.00
R6364:Fam129c UTSW 8 71599089 missense probably benign 0.08
R6888:Fam129c UTSW 8 71603739 missense probably benign
R6890:Fam129c UTSW 8 71605671 missense probably damaging 1.00
R7383:Fam129c UTSW 8 71603826 missense possibly damaging 0.86
R7441:Fam129c UTSW 8 71600164 missense probably benign 0.34
R7459:Fam129c UTSW 8 71605027 missense possibly damaging 0.75
R7527:Fam129c UTSW 8 71606698 missense probably damaging 0.99
R7873:Fam129c UTSW 8 71602248 missense probably damaging 1.00
R7956:Fam129c UTSW 8 71602248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCAACATATTTGGAAGAAAGGCT -3'
(R):5'- GTCAGCACCACTGAGAATGCAAGA -3'

Sequencing Primer
(F):5'- gactgctttccaccttattcac -3'
(R):5'- TGCAAGAGAGACAACTACAGC -3'
Posted On2013-07-11