Incidental Mutation 'R7214:BC005561'
ID561289
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R7214 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104522363 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1584 (T1584A)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect probably benign
Transcript: ENSMUST00000096452
AA Change: T1584A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: T1584A

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 C T 8: 94,934,018 T95I Het
Arap2 C T 5: 62,749,338 V113I probably benign Het
Arntl T A 7: 113,299,403 I346K probably benign Het
Atraid C T 5: 31,052,246 Q85* probably null Het
Bcdin3d T C 15: 99,470,463 D285G probably benign Het
Carmil3 T C 14: 55,498,612 W604R probably damaging Het
Ccl6 C T 11: 83,589,756 probably null Het
Cct4 C T 11: 22,990,616 probably benign Het
Cd2ap C T 17: 42,845,394 R84Q possibly damaging Het
Cdt1 T A 8: 122,568,273 probably null Het
Cln3 C T 7: 126,582,770 G40D probably damaging Het
Crlf3 T C 11: 80,064,390 S47G possibly damaging Het
Csrp3 T C 7: 48,830,637 K193R probably benign Het
Cxcl3 A C 5: 90,786,360 E33A probably damaging Het
Cyp11b1 T C 15: 74,836,859 D362G probably benign Het
Dnah2 T C 11: 69,431,109 D3795G probably damaging Het
Dnah3 G A 7: 119,922,742 A4076V probably damaging Het
Dnaja3 T A 16: 4,701,182 I380N possibly damaging Het
Dock10 T A 1: 80,568,529 H785L probably benign Het
Dopey2 T G 16: 93,810,135 F2226V possibly damaging Het
Dscaml1 A T 9: 45,670,139 I419F probably benign Het
Dyrk4 T A 6: 126,885,237 I431F probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Endog C T 2: 30,172,890 R181C probably damaging Het
Fam90a1a A T 8: 21,963,625 Y332F probably benign Het
Fastkd3 T C 13: 68,589,380 I588T probably benign Het
Galnt9 G A 5: 110,589,828 V217I probably benign Het
Gm973 A T 1: 59,562,729 R501* probably null Het
Gnptab C T 10: 88,379,157 probably benign Het
Gpn1 T C 5: 31,503,417 F184S probably damaging Het
Imp3 G T 9: 56,937,723 V73L probably benign Het
Ipo11 T C 13: 106,895,857 D259G probably null Het
Jag1 T C 2: 137,106,882 S142G probably benign Het
Klhl5 A T 5: 65,131,755 E120V probably benign Het
Lct C A 1: 128,300,460 V1099L probably benign Het
Lrba G C 3: 86,328,326 W912C probably damaging Het
Lss C T 10: 76,547,471 T535I probably damaging Het
Mcts2 T C 2: 152,687,377 I36T probably benign Het
Meikin T A 11: 54,411,912 N383K probably benign Het
Myo1g T C 11: 6,511,055 Y663C probably damaging Het
Nadk2 T A 15: 9,108,254 M419K probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfat5 T C 8: 107,293,883 S20P probably damaging Het
Nlrp1a C T 11: 71,123,293 C377Y probably damaging Het
Nlrp9a T C 7: 26,551,038 V76A probably damaging Het
Nrap C A 19: 56,378,135 A341S probably benign Het
Ntng2 T C 2: 29,227,720 S239G probably damaging Het
Nup188 T A 2: 30,307,554 C207S possibly damaging Het
Olfr1077-ps1 C T 2: 86,525,806 V124I probably damaging Het
Olfr1328 T A 4: 118,933,949 I300F possibly damaging Het
Olfr1474 T A 19: 13,470,973 M1K probably null Het
Olfr17 T C 7: 107,098,412 *316R probably null Het
Olfr346 T C 2: 36,688,095 I31T probably benign Het
Olfr705 T C 7: 106,874,267 probably benign Het
Olfr891 A C 9: 38,180,022 V267G probably damaging Het
Pcdhgb2 C A 18: 37,690,106 A50E probably damaging Het
Pgap1 A T 1: 54,543,061 M209K possibly damaging Het
Plbd1 T A 6: 136,612,831 D463V probably damaging Het
Plcg2 T A 8: 117,583,549 I380N probably damaging Het
Pnpt1 T C 11: 29,137,285 W184R probably damaging Het
Pptc7 G A 5: 122,313,777 V202I probably benign Het
Prpf6 C T 2: 181,640,596 A510V probably damaging Het
Prr5l T C 2: 101,729,432 Y235C probably benign Het
Ptprk T C 10: 28,574,909 V1022A probably benign Het
Rbl2 T C 8: 91,083,429 probably null Het
Rmnd1 T C 10: 4,410,753 K348E probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Sacs T A 14: 61,191,792 N433K probably benign Het
Scyl1 T C 19: 5,760,029 T590A probably benign Het
Sdhd A G 9: 50,597,233 V111A possibly damaging Het
Sec24b G T 3: 130,033,860 P330Q probably benign Het
Serpinb6d C T 13: 33,664,145 P31S probably damaging Het
Slc26a9 A T 1: 131,759,473 R457W probably damaging Het
Slc5a8 G A 10: 88,919,502 M490I probably benign Het
Slx4 A G 16: 3,988,980 I533T probably benign Het
Slx4ip T A 2: 137,046,730 F110L probably benign Het
Smchd1 T C 17: 71,345,364 R2000G probably benign Het
Snx8 T C 5: 140,360,253 E75G possibly damaging Het
Stab2 C A 10: 86,899,841 C1292F probably damaging Het
Swt1 A T 1: 151,394,613 M617K possibly damaging Het
Tiam2 T A 17: 3,518,412 I1611N possibly damaging Het
Tmem63b T G 17: 45,661,822 N682T probably benign Het
Trio C T 15: 27,871,187 V674M probably damaging Het
Trpc3 G A 3: 36,650,137 T557M possibly damaging Het
Vac14 T G 8: 110,671,042 L463R probably damaging Het
Vmn2r43 C T 7: 8,253,380 probably null Het
Wdr49 A T 3: 75,358,444 Y232N possibly damaging Het
Wdr90 T C 17: 25,845,393 M1835V probably benign Het
Xpc T C 6: 91,492,338 E809G probably damaging Het
Zfhx3 A T 8: 108,948,861 Q2181L probably damaging Het
Zfp442 T C 2: 150,409,281 T234A probably benign Het
Zfp764 A T 7: 127,405,278 M227K probably benign Het
Zfp957 A G 14: 79,213,310 S350P unknown Het
Zscan29 T A 2: 121,169,280 K147* probably null Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7494:BC005561 UTSW 5 104518418 missense possibly damaging 0.90
R7733:BC005561 UTSW 5 104519960 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAGTGAAAGTCCCTGTGAGTCTC -3'
(R):5'- TGTCTCGAGAGGATAGCGATG -3'

Sequencing Primer
(F):5'- CCTGTGAGTCTCTTTATCCAAATGAG -3'
(R):5'- CTCGAGAGGATAGCGATGTATATTC -3'
Posted On2019-06-26