Incidental Mutation 'R7214:Smchd1'
ID561350
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene NameSMC hinge domain containing 1
Synonyms4931400A14Rik, MommeD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R7214 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71344489-71475343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71345364 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 2000 (R2000G)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
Predicted Effect probably benign
Transcript: ENSMUST00000127430
AA Change: R2000G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: R2000G

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 C T 8: 94,934,018 T95I Het
Arap2 C T 5: 62,749,338 V113I probably benign Het
Arntl T A 7: 113,299,403 I346K probably benign Het
Atraid C T 5: 31,052,246 Q85* probably null Het
BC005561 A G 5: 104,522,363 T1584A probably benign Het
Bcdin3d T C 15: 99,470,463 D285G probably benign Het
Carmil3 T C 14: 55,498,612 W604R probably damaging Het
Ccl6 C T 11: 83,589,756 probably null Het
Cct4 C T 11: 22,990,616 probably benign Het
Cd2ap C T 17: 42,845,394 R84Q possibly damaging Het
Cdt1 T A 8: 122,568,273 probably null Het
Cln3 C T 7: 126,582,770 G40D probably damaging Het
Crlf3 T C 11: 80,064,390 S47G possibly damaging Het
Csrp3 T C 7: 48,830,637 K193R probably benign Het
Cxcl3 A C 5: 90,786,360 E33A probably damaging Het
Cyp11b1 T C 15: 74,836,859 D362G probably benign Het
Dnah2 T C 11: 69,431,109 D3795G probably damaging Het
Dnah3 G A 7: 119,922,742 A4076V probably damaging Het
Dnaja3 T A 16: 4,701,182 I380N possibly damaging Het
Dock10 T A 1: 80,568,529 H785L probably benign Het
Dopey2 T G 16: 93,810,135 F2226V possibly damaging Het
Dscaml1 A T 9: 45,670,139 I419F probably benign Het
Dyrk4 T A 6: 126,885,237 I431F probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Endog C T 2: 30,172,890 R181C probably damaging Het
Fam90a1a A T 8: 21,963,625 Y332F probably benign Het
Fastkd3 T C 13: 68,589,380 I588T probably benign Het
Galnt9 G A 5: 110,589,828 V217I probably benign Het
Gm973 A T 1: 59,562,729 R501* probably null Het
Gnptab C T 10: 88,379,157 probably benign Het
Gpn1 T C 5: 31,503,417 F184S probably damaging Het
Imp3 G T 9: 56,937,723 V73L probably benign Het
Ipo11 T C 13: 106,895,857 D259G probably null Het
Jag1 T C 2: 137,106,882 S142G probably benign Het
Klhl5 A T 5: 65,131,755 E120V probably benign Het
Lct C A 1: 128,300,460 V1099L probably benign Het
Lrba G C 3: 86,328,326 W912C probably damaging Het
Lss C T 10: 76,547,471 T535I probably damaging Het
Mcts2 T C 2: 152,687,377 I36T probably benign Het
Meikin T A 11: 54,411,912 N383K probably benign Het
Myo1g T C 11: 6,511,055 Y663C probably damaging Het
Nadk2 T A 15: 9,108,254 M419K probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfat5 T C 8: 107,293,883 S20P probably damaging Het
Nlrp1a C T 11: 71,123,293 C377Y probably damaging Het
Nlrp9a T C 7: 26,551,038 V76A probably damaging Het
Nrap C A 19: 56,378,135 A341S probably benign Het
Ntng2 T C 2: 29,227,720 S239G probably damaging Het
Nup188 T A 2: 30,307,554 C207S possibly damaging Het
Olfr1077-ps1 C T 2: 86,525,806 V124I probably damaging Het
Olfr1328 T A 4: 118,933,949 I300F possibly damaging Het
Olfr1474 T A 19: 13,470,973 M1K probably null Het
Olfr17 T C 7: 107,098,412 *316R probably null Het
Olfr346 T C 2: 36,688,095 I31T probably benign Het
Olfr705 T C 7: 106,874,267 probably benign Het
Olfr891 A C 9: 38,180,022 V267G probably damaging Het
Pcdhgb2 C A 18: 37,690,106 A50E probably damaging Het
Pgap1 A T 1: 54,543,061 M209K possibly damaging Het
Plbd1 T A 6: 136,612,831 D463V probably damaging Het
Plcg2 T A 8: 117,583,549 I380N probably damaging Het
Pnpt1 T C 11: 29,137,285 W184R probably damaging Het
Pptc7 G A 5: 122,313,777 V202I probably benign Het
Prpf6 C T 2: 181,640,596 A510V probably damaging Het
Prr5l T C 2: 101,729,432 Y235C probably benign Het
Ptprk T C 10: 28,574,909 V1022A probably benign Het
Rbl2 T C 8: 91,083,429 probably null Het
Rmnd1 T C 10: 4,410,753 K348E probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Sacs T A 14: 61,191,792 N433K probably benign Het
Scyl1 T C 19: 5,760,029 T590A probably benign Het
Sdhd A G 9: 50,597,233 V111A possibly damaging Het
Sec24b G T 3: 130,033,860 P330Q probably benign Het
Serpinb6d C T 13: 33,664,145 P31S probably damaging Het
Slc26a9 A T 1: 131,759,473 R457W probably damaging Het
Slc5a8 G A 10: 88,919,502 M490I probably benign Het
Slx4 A G 16: 3,988,980 I533T probably benign Het
Slx4ip T A 2: 137,046,730 F110L probably benign Het
Snx8 T C 5: 140,360,253 E75G possibly damaging Het
Stab2 C A 10: 86,899,841 C1292F probably damaging Het
Swt1 A T 1: 151,394,613 M617K possibly damaging Het
Tiam2 T A 17: 3,518,412 I1611N possibly damaging Het
Tmem63b T G 17: 45,661,822 N682T probably benign Het
Trio C T 15: 27,871,187 V674M probably damaging Het
Trpc3 G A 3: 36,650,137 T557M possibly damaging Het
Vac14 T G 8: 110,671,042 L463R probably damaging Het
Vmn2r43 C T 7: 8,253,380 probably null Het
Wdr49 A T 3: 75,358,444 Y232N possibly damaging Het
Wdr90 T C 17: 25,845,393 M1835V probably benign Het
Xpc T C 6: 91,492,338 E809G probably damaging Het
Zfhx3 A T 8: 108,948,861 Q2181L probably damaging Het
Zfp442 T C 2: 150,409,281 T234A probably benign Het
Zfp764 A T 7: 127,405,278 M227K probably benign Het
Zfp957 A G 14: 79,213,310 S350P unknown Het
Zscan29 T A 2: 121,169,280 K147* probably null Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TACATTTGCAAGCCAGCCAC -3'
(R):5'- AGTTAGAGCAGAGTTCATGTGATAG -3'

Sequencing Primer
(F):5'- AAGCCAGCCACCGACGG -3'
(R):5'- TTCTGAAACGATCAAGGAGTTTAGG -3'
Posted On2019-06-26