Incidental Mutation 'R7215:Inpp5d'
ID561358
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R7215 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87701218 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 620 (H620L)
Ref Sequence ENSEMBL: ENSMUSP00000127941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
Predicted Effect probably benign
Transcript: ENSMUST00000042275
AA Change: H619L

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: H619L

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072999
AA Change: H619L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: H619L

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167032
AA Change: H357L

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: H357L

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168783
AA Change: H620L

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: H620L

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169754
AA Change: H620L

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: H620L

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170300
AA Change: H357L

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: H357L

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87665399 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAGCTAATTATGGTGATGGTGCAGC -3'
(R):5'- GAAACAGACGCATGGCCATC -3'

Sequencing Primer
(F):5'- ATGGTGCAGCCCTTCTAGG -3'
(R):5'- AGACGCATGGCCATCAGTTTG -3'
Posted On2019-06-26