Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Inpp5d'

561358

Institutional Source

Beutler Lab

Gene Symbol

Inpp5d

Ensembl Gene

ENSMUSG00000026288

Gene Name

inositol polyphosphate-5-phosphatase D

Synonyms

s-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87620312-87720507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 87701218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 620 (H620L)

Ref Sequence

ENSEMBL: ENSMUSP00000127941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]

AlphaFold

Q9ES52

Predicted Effect

probably benign
Transcript: ENSMUST00000042275
AA Change: H619L

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: H619L

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	954	979	N/A	INTRINSIC
low complexity region	1045	1057	N/A	INTRINSIC
low complexity region	1119	1131	N/A	INTRINSIC
low complexity region	1139	1148	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000072999
AA Change: H619L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: H619L

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	932	953	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167032
AA Change: H357L

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: H357L

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	692	717	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168783
AA Change: H620L

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: H620L

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	4.5e-104	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1059	1071	N/A	INTRINSIC
low complexity region	1079	1088	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169754
AA Change: H620L

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: H620L

Domain	Start	End	E-Value	Type
SH2	6	95	4.6e-31	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	2.2e-106	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	955	980	N/A	INTRINSIC
low complexity region	1046	1058	N/A	INTRINSIC
low complexity region	1120	1132	N/A	INTRINSIC
low complexity region	1140	1149	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170300
AA Change: H357L

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: H357L

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	796	808	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Inpp5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Inpp5d	APN	1	87683815	missense	probably benign	0.00
IGL00329:Inpp5d	APN	1	87668003	missense	probably benign	0.00
IGL00897:Inpp5d	APN	1	87712114	missense	probably benign	0.14
IGL01314:Inpp5d	APN	1	87683750	nonsense	probably null
IGL02145:Inpp5d	APN	1	87715055	missense	probably damaging	1.00
IGL02422:Inpp5d	APN	1	87708132	missense	probably damaging	1.00
IGL02538:Inpp5d	APN	1	87695366	missense	probably null	0.92
IGL02680:Inpp5d	APN	1	87701483	missense	possibly damaging	0.87
IGL03083:Inpp5d	APN	1	87711141	missense	probably damaging	1.00
IGL03308:Inpp5d	APN	1	87703197	missense	probably damaging	1.00
americas	UTSW	1	87715142	missense	probably damaging	1.00
Apfelsine	UTSW	1	87683845	nonsense	probably null
Auburn	UTSW	1	87681680	splice site	probably null
Autumnal	UTSW	1	87691711	missense	probably damaging	0.97
Gourd	UTSW	1	87697615	intron	probably benign
lyda	UTSW	1	87683762	missense	probably damaging	1.00
Mandarin	UTSW	1	87709626	missense	probably damaging	0.99
naranjo	UTSW	1	87708211	critical splice donor site	probably null
New_black	UTSW	1	87709675	missense	probably damaging	1.00
Orange	UTSW	1	87697546	critical splice donor site	probably null
pantone	UTSW	1	87699675	missense	probably damaging	1.00
sailing	UTSW	1	87705964	missense	probably damaging	1.00
Salamander	UTSW	1	87695380	missense	probably damaging	0.99
Sandstone	UTSW	1	87695400	missense	probably damaging	1.00
styx	UTSW	1	87669784	critical splice donor site	probably benign
tangerine	UTSW	1	87705949	missense	probably damaging	1.00
ulster	UTSW	1	87701476	nonsense	probably null
R0010:Inpp5d	UTSW	1	87697546	critical splice donor site	probably null
R0037:Inpp5d	UTSW	1	87708129	missense	probably damaging	0.99
R0087:Inpp5d	UTSW	1	87715138	missense	probably damaging	1.00
R0492:Inpp5d	UTSW	1	87698150	missense	possibly damaging	0.94
R0520:Inpp5d	UTSW	1	87705920	splice site	probably benign
R0733:Inpp5d	UTSW	1	87668077	splice site	probably benign
R1464:Inpp5d	UTSW	1	87698105	splice site	probably benign
R1576:Inpp5d	UTSW	1	87669685	missense	probably benign	0.16
R1576:Inpp5d	UTSW	1	87681558	missense	probably damaging	0.96
R1592:Inpp5d	UTSW	1	87665532	missense	possibly damaging	0.90
R1750:Inpp5d	UTSW	1	87699081	missense	probably damaging	1.00
R1774:Inpp5d	UTSW	1	87667889	missense	probably benign	0.30
R1972:Inpp5d	UTSW	1	87676314	missense	probably benign	0.00
R2024:Inpp5d	UTSW	1	87695350	nonsense	probably null
R2405:Inpp5d	UTSW	1	87699729	missense	possibly damaging	0.94
R3412:Inpp5d	UTSW	1	87668057	missense	possibly damaging	0.93
R3414:Inpp5d	UTSW	1	87668057	missense	possibly damaging	0.93
R3756:Inpp5d	UTSW	1	87701408	splice site	probably benign
R4652:Inpp5d	UTSW	1	87665451	missense	probably benign	0.03
R4676:Inpp5d	UTSW	1	87715142	missense	probably damaging	1.00
R4834:Inpp5d	UTSW	1	87697523	missense	possibly damaging	0.52
R5086:Inpp5d	UTSW	1	87705964	missense	probably damaging	1.00
R5159:Inpp5d	UTSW	1	87676342	missense	probably damaging	1.00
R5250:Inpp5d	UTSW	1	87709675	missense	probably damaging	1.00
R5442:Inpp5d	UTSW	1	87718066	missense	probably benign	0.02
R5875:Inpp5d	UTSW	1	87717974	missense	possibly damaging	0.47
R6135:Inpp5d	UTSW	1	87620397	splice site	probably null
R6371:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6385:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6386:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6526:Inpp5d	UTSW	1	87676250	start gained	probably benign
R6572:Inpp5d	UTSW	1	87695396	missense	probably damaging	0.99
R6831:Inpp5d	UTSW	1	87701476	nonsense	probably null
R6853:Inpp5d	UTSW	1	87681680	splice site	probably null
R6883:Inpp5d	UTSW	1	87699690	missense	probably damaging	0.98
R7082:Inpp5d	UTSW	1	87695380	missense	probably damaging	0.99
R7418:Inpp5d	UTSW	1	87708211	critical splice donor site	probably null
R7471:Inpp5d	UTSW	1	87695400	missense	probably damaging	1.00
R7593:Inpp5d	UTSW	1	87717778	missense	possibly damaging	0.82
R7716:Inpp5d	UTSW	1	87665399	missense	probably damaging	0.97
R7781:Inpp5d	UTSW	1	87699672	missense	probably damaging	1.00
R7808:Inpp5d	UTSW	1	87683845	nonsense	probably null
R7920:Inpp5d	UTSW	1	87705949	missense	probably damaging	1.00
R8788:Inpp5d	UTSW	1	87683762	missense	probably damaging	1.00
R8839:Inpp5d	UTSW	1	87691711	missense	probably damaging	0.97
R8905:Inpp5d	UTSW	1	87709626	missense	probably damaging	0.99
R8906:Inpp5d	UTSW	1	87697615	intron	probably benign
R9517:Inpp5d	UTSW	1	87711131	missense	probably benign	0.01
R9667:Inpp5d	UTSW	1	87695406	missense	probably damaging	1.00
R9716:Inpp5d	UTSW	1	87697469	missense	possibly damaging	0.90
Z1176:Inpp5d	UTSW	1	87669709	missense	probably benign	0.16
Z1176:Inpp5d	UTSW	1	87703131	missense	probably damaging	1.00
Z1191:Inpp5d	UTSW	1	87683770	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGCTAATTATGGTGATGGTGCAGC -3'
(R):5'- GAAACAGACGCATGGCCATC -3'

Sequencing Primer
(F):5'- ATGGTGCAGCCCTTCTAGG -3'
(R):5'- AGACGCATGGCCATCAGTTTG -3'

Posted On

2019-06-26