Incidental Mutation 'R7215:Or5al1'
ID 561364
Institutional Source Beutler Lab
Gene Symbol Or5al1
Ensembl Gene ENSMUSG00000075202
Gene Name olfactory receptor family 5 subfamily AL member 1
Synonyms Olfr1042, MOR185-10, GA_x6K02T2Q125-47629317-47628376
MMRRC Submission 045287-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7215 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 85989689-85990785 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85989800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 305 (V305I)
Ref Sequence ENSEMBL: ENSMUSP00000151053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]
AlphaFold Q7TR81
Predicted Effect probably benign
Transcript: ENSMUST00000099907
SMART Domains Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.9e-46 PFAM
Pfam:7tm_1 41 290 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099908
AA Change: V305I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202
AA Change: V305I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213886
Predicted Effect probably benign
Transcript: ENSMUST00000213949
Predicted Effect probably benign
Transcript: ENSMUST00000215624
AA Change: V305I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216028
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,471,690 (GRCm39) V1032M possibly damaging Het
Abca13 T A 11: 9,238,405 (GRCm39) probably null Het
Adamts14 T A 10: 61,047,375 (GRCm39) H739L possibly damaging Het
Adgrl3 A G 5: 81,841,397 (GRCm39) E758G probably damaging Het
Ano3 T A 2: 110,496,277 (GRCm39) T826S probably damaging Het
Arhgap45 C T 10: 79,861,316 (GRCm39) T493I possibly damaging Het
Atg9b A C 5: 24,593,039 (GRCm39) W455G probably damaging Het
Atp4a A G 7: 30,416,785 (GRCm39) N496S possibly damaging Het
Bckdk T A 7: 127,504,282 (GRCm39) D60E possibly damaging Het
Blmh A T 11: 76,856,725 (GRCm39) K244* probably null Het
Btbd17 T C 11: 114,682,291 (GRCm39) I474V possibly damaging Het
C87436 A G 6: 86,439,662 (GRCm39) E451G possibly damaging Het
Camta1 T C 4: 151,229,194 (GRCm39) E546G probably damaging Het
Casp1 A G 9: 5,298,523 (GRCm39) probably null Het
Ccdc116 A G 16: 16,957,792 (GRCm39) Y456H probably damaging Het
Cep350 A C 1: 155,770,453 (GRCm39) S1812R possibly damaging Het
Chrna10 A G 7: 101,761,415 (GRCm39) L392P possibly damaging Het
Col22a1 A T 15: 71,842,181 (GRCm39) C434* probably null Het
Cxcl9 G A 5: 92,471,747 (GRCm39) Q98* probably null Het
Cyp2c54 G A 19: 40,034,626 (GRCm39) T348I probably damaging Het
Dnah7a G A 1: 53,657,509 (GRCm39) R756C probably damaging Het
Dnajc18 T C 18: 35,815,034 (GRCm39) T239A probably benign Het
Dnase2a A T 8: 85,636,399 (GRCm39) probably null Het
Dpyd A G 3: 119,059,681 (GRCm39) T793A probably benign Het
Edil3 T C 13: 88,970,169 (GRCm39) probably null Het
Ehd1 T A 19: 6,347,672 (GRCm39) I342N possibly damaging Het
Erbb4 A T 1: 68,378,619 (GRCm39) S341T probably benign Het
Ezh1 T A 11: 101,106,125 (GRCm39) T87S probably benign Het
Fam20b A T 1: 156,518,123 (GRCm39) W224R probably damaging Het
Galns A T 8: 123,326,087 (GRCm39) probably null Het
Gm13283 C T 4: 88,678,967 (GRCm39) probably benign Het
Gm49342 A T 14: 51,182,040 (GRCm39) M23L probably benign Het
Gm5114 T A 7: 39,060,795 (GRCm39) H18L probably benign Het
Gpr89 A G 3: 96,787,404 (GRCm39) W299R probably damaging Het
Hadha G T 5: 30,324,840 (GRCm39) N755K probably benign Het
Inpp5d A T 1: 87,628,940 (GRCm39) H620L probably benign Het
Klk1b3 T A 7: 43,849,828 (GRCm39) probably null Het
Macf1 T C 4: 123,401,097 (GRCm39) T663A probably damaging Het
Man1b1 A G 2: 25,240,402 (GRCm39) N601S probably benign Het
Mbtps1 A G 8: 120,251,307 (GRCm39) V605A possibly damaging Het
Med23 C G 10: 24,764,327 (GRCm39) D311E probably benign Het
Myo3a G T 2: 22,250,378 (GRCm39) D82Y possibly damaging Het
Nsd1 T A 13: 55,395,454 (GRCm39) D1121E probably benign Het
Odad1 C T 7: 45,586,046 (GRCm39) R148C probably damaging Het
Or4c116 G A 2: 88,942,845 (GRCm39) Q4* probably null Het
Or8b3b A G 9: 38,584,743 (GRCm39) I12T probably benign Het
Otoa T C 7: 120,717,795 (GRCm39) V19A unknown Het
Pcdhb20 A T 18: 37,638,439 (GRCm39) T322S probably benign Het
Pecam1 T C 11: 106,586,745 (GRCm39) T257A probably benign Het
Pi16 G T 17: 29,538,072 (GRCm39) probably benign Het
Pik3c2g C T 6: 139,700,589 (GRCm39) T293M Het
Pira13 C T 7: 3,825,310 (GRCm39) C444Y unknown Het
Pkhd1l1 T A 15: 44,391,559 (GRCm39) C1542S possibly damaging Het
Prrc2b G A 2: 32,119,309 (GRCm39) G2172R probably damaging Het
Prrt1 A T 17: 34,848,677 (GRCm39) probably null Het
Ptprb T A 10: 116,174,681 (GRCm39) N784K possibly damaging Het
Rem1 C A 2: 152,470,069 (GRCm39) S18R probably damaging Het
Ripk4 G A 16: 97,548,523 (GRCm39) probably null Het
Scn8a G A 15: 100,927,711 (GRCm39) V1397I possibly damaging Het
Setbp1 T A 18: 78,900,052 (GRCm39) H1205L probably damaging Het
Shmt1 T C 11: 60,692,361 (GRCm39) I132V probably damaging Het
Slc24a1 T A 9: 64,835,785 (GRCm39) T781S unknown Het
Sncaip C T 18: 53,040,415 (GRCm39) Q870* probably null Het
Stab1 A T 14: 30,882,754 (GRCm39) N416K possibly damaging Het
Tcea1 A G 1: 4,937,706 (GRCm39) D26G probably damaging Het
Tcf20 A T 15: 82,737,690 (GRCm39) S1254T probably benign Het
Tead4 T A 6: 128,205,641 (GRCm39) I354F probably damaging Het
Tex36 G A 7: 133,189,147 (GRCm39) R142* probably null Het
Trav6d-3 T A 14: 52,962,799 (GRCm39) L12Q probably damaging Het
Trpc4 A G 3: 54,102,317 (GRCm39) T72A possibly damaging Het
Trrap G A 5: 144,733,945 (GRCm39) A933T probably benign Het
Tspoap1 T A 11: 87,661,315 (GRCm39) I589N probably benign Het
Ttll5 T A 12: 85,980,170 (GRCm39) V918E probably benign Het
Tut4 T C 4: 108,384,205 (GRCm39) Y1091H probably damaging Het
Txn2 A G 15: 77,811,886 (GRCm39) probably null Het
Ucn3 T G 13: 3,991,365 (GRCm39) T96P probably benign Het
Usp36 T C 11: 118,155,980 (GRCm39) E764G possibly damaging Het
Vmn2r23 A T 6: 123,681,323 (GRCm39) H77L probably benign Het
Vmn2r57 T C 7: 41,049,710 (GRCm39) T680A probably benign Het
Vwa3a T C 7: 120,394,853 (GRCm39) I891T possibly damaging Het
Zfp764l1 A G 7: 126,990,695 (GRCm39) S431P probably benign Het
Zhx2 A G 15: 57,687,039 (GRCm39) I803V probably benign Het
Other mutations in Or5al1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Or5al1 APN 2 85,990,391 (GRCm39) missense probably benign 0.04
IGL02071:Or5al1 APN 2 85,990,219 (GRCm39) missense probably benign
IGL02935:Or5al1 APN 2 85,990,714 (GRCm39) unclassified probably benign
IGL03152:Or5al1 APN 2 85,990,030 (GRCm39) missense possibly damaging 0.95
R0089:Or5al1 UTSW 2 85,989,918 (GRCm39) missense possibly damaging 0.89
R1419:Or5al1 UTSW 2 85,989,773 (GRCm39) makesense probably null
R1699:Or5al1 UTSW 2 85,990,280 (GRCm39) missense probably benign
R1804:Or5al1 UTSW 2 85,990,417 (GRCm39) missense probably benign 0.38
R3162:Or5al1 UTSW 2 85,990,439 (GRCm39) missense probably benign 0.03
R3162:Or5al1 UTSW 2 85,990,439 (GRCm39) missense probably benign 0.03
R3609:Or5al1 UTSW 2 85,989,976 (GRCm39) missense probably benign 0.00
R3953:Or5al1 UTSW 2 85,990,282 (GRCm39) missense probably benign 0.02
R3955:Or5al1 UTSW 2 85,990,282 (GRCm39) missense probably benign 0.02
R3956:Or5al1 UTSW 2 85,990,282 (GRCm39) missense probably benign 0.02
R3957:Or5al1 UTSW 2 85,990,282 (GRCm39) missense probably benign 0.02
R4771:Or5al1 UTSW 2 85,990,417 (GRCm39) missense probably benign 0.38
R5685:Or5al1 UTSW 2 85,990,139 (GRCm39) missense probably damaging 0.99
R6241:Or5al1 UTSW 2 85,990,380 (GRCm39) missense probably damaging 1.00
R6324:Or5al1 UTSW 2 85,989,800 (GRCm39) missense probably benign
R6678:Or5al1 UTSW 2 85,990,529 (GRCm39) missense probably damaging 0.98
R6921:Or5al1 UTSW 2 85,990,196 (GRCm39) missense probably benign 0.02
R7386:Or5al1 UTSW 2 85,989,874 (GRCm39) missense possibly damaging 0.83
R8030:Or5al1 UTSW 2 85,990,586 (GRCm39) missense probably benign
R9694:Or5al1 UTSW 2 85,990,681 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCATTCAGTTTCACAGAGCC -3'
(R):5'- ACTTGTGCATCCCACCTGAC -3'

Sequencing Primer
(F):5'- TCCATTTCATTTGAAGTTACTGGG -3'
(R):5'- CCTGACTTCCATCACCATATTTTATG -3'
Posted On 2019-06-26