Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Ano3'

561366

Institutional Source

Beutler Lab

Gene Symbol

Ano3

Ensembl Gene

ENSMUSG00000074968

Gene Name

anoctamin 3

Synonyms

Tmem16c, B230324K02Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110655201-110950923 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110665932 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 826 (T826S)

Ref Sequence

ENSEMBL: ENSMUSP00000097219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099623]

AlphaFold

A2AHL1

Predicted Effect

probably damaging
Transcript: ENSMUST00000099623
AA Change: T826S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: T826S

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	156	381	2.9e-70	PFAM
Pfam:Anoctamin	384	950	4.4e-138	PFAM

Meta Mutation Damage Score

0.1219

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Ano3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Ano3	APN	2	110771050	splice site	probably benign
IGL01066:Ano3	APN	2	110661445	missense	probably null	0.00
IGL01696:Ano3	APN	2	110667737	missense	probably damaging	1.00
IGL01729:Ano3	APN	2	110781394	splice site	probably null
IGL01785:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01786:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01992:Ano3	APN	2	110658219	missense	probably damaging	1.00
IGL02098:Ano3	APN	2	110666441	nonsense	probably null
IGL02333:Ano3	APN	2	110697199	splice site	probably benign
IGL02346:Ano3	APN	2	110770926	splice site	probably benign
IGL02352:Ano3	APN	2	110884943	nonsense	probably null
IGL02359:Ano3	APN	2	110884943	nonsense	probably null
IGL02544:Ano3	APN	2	110658249	missense	possibly damaging	0.79
IGL02750:Ano3	APN	2	110665984	splice site	probably benign
IGL02861:Ano3	APN	2	110738812	missense	probably damaging	1.00
IGL02948:Ano3	APN	2	110697018	splice site	probably benign
IGL03327:Ano3	APN	2	110697178	missense	possibly damaging	0.62
3-1:Ano3	UTSW	2	110697124	missense	probably damaging	1.00
IGL02988:Ano3	UTSW	2	110775010	missense	probably damaging	1.00
IGL03147:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
R0349:Ano3	UTSW	2	110661487	missense	probably damaging	1.00
R0426:Ano3	UTSW	2	110661174	missense	probably damaging	1.00
R0523:Ano3	UTSW	2	110884855	missense	probably benign	0.13
R0557:Ano3	UTSW	2	110862952	splice site	probably null
R0611:Ano3	UTSW	2	110885001	missense	possibly damaging	0.93
R0891:Ano3	UTSW	2	110697976	missense	probably benign	0.03
R1459:Ano3	UTSW	2	110880829	missense	probably benign	0.00
R1460:Ano3	UTSW	2	110682758	missense	probably damaging	0.97
R1773:Ano3	UTSW	2	110761455	missense	probably damaging	1.00
R1874:Ano3	UTSW	2	110884872	missense	probably benign	0.00
R1919:Ano3	UTSW	2	110885007	missense	probably benign
R2185:Ano3	UTSW	2	110775045	missense	probably benign	0.01
R2280:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2281:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2348:Ano3	UTSW	2	110783743	missense	possibly damaging	0.82
R2425:Ano3	UTSW	2	110862843	missense	probably benign
R2697:Ano3	UTSW	2	110794960	missense	possibly damaging	0.79
R3888:Ano3	UTSW	2	110885000	missense	probably damaging	0.99
R3923:Ano3	UTSW	2	110770959	missense	probably damaging	1.00
R4352:Ano3	UTSW	2	110745894	missense	possibly damaging	0.74
R4447:Ano3	UTSW	2	110761578	splice site	probably null
R4790:Ano3	UTSW	2	110884919	missense	probably benign
R4832:Ano3	UTSW	2	110667722	missense	probably damaging	1.00
R4916:Ano3	UTSW	2	110771020	missense	possibly damaging	0.74
R5113:Ano3	UTSW	2	110661480	missense	possibly damaging	0.61
R5486:Ano3	UTSW	2	110745870	missense	probably damaging	1.00
R5498:Ano3	UTSW	2	110697103	missense	possibly damaging	0.68
R5589:Ano3	UTSW	2	110884995	missense	probably damaging	0.99
R5627:Ano3	UTSW	2	110756953	missense	possibly damaging	0.61
R5741:Ano3	UTSW	2	110658273	missense	probably benign	0.11
R5767:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R5883:Ano3	UTSW	2	110880864	missense	probably null	0.15
R5899:Ano3	UTSW	2	110862887	missense	probably benign	0.39
R5916:Ano3	UTSW	2	110681836	missense	probably benign	0.29
R6158:Ano3	UTSW	2	110665875	missense	probably damaging	1.00
R6315:Ano3	UTSW	2	110697039	missense	probably damaging	1.00
R6401:Ano3	UTSW	2	110775114	missense	probably benign	0.01
R6481:Ano3	UTSW	2	110795027	missense	probably benign	0.16
R6482:Ano3	UTSW	2	110697055	missense	probably damaging	1.00
R6587:Ano3	UTSW	2	110797904	splice site	probably null
R6811:Ano3	UTSW	2	110880867	missense	probably benign	0.03
R7048:Ano3	UTSW	2	110682771	nonsense	probably null
R7145:Ano3	UTSW	2	110862860	missense	probably benign	0.31
R7207:Ano3	UTSW	2	110781423	missense	probably damaging	0.96
R7366:Ano3	UTSW	2	110757067	missense	probably damaging	1.00
R7371:Ano3	UTSW	2	110884849	critical splice donor site	probably null
R7568:Ano3	UTSW	2	110950293	start gained	probably benign
R7636:Ano3	UTSW	2	110682703	nonsense	probably null
R7888:Ano3	UTSW	2	110666428	missense	probably damaging	1.00
R7992:Ano3	UTSW	2	110775022	missense	possibly damaging	0.77
R8024:Ano3	UTSW	2	110667783	missense	probably damaging	0.99
R8074:Ano3	UTSW	2	110950232	start gained	probably benign
R8111:Ano3	UTSW	2	110783713	missense	possibly damaging	0.95
R8177:Ano3	UTSW	2	110666456	missense	probably damaging	1.00
R8297:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R8485:Ano3	UTSW	2	110667855	critical splice acceptor site	probably null
R8509:Ano3	UTSW	2	110665835	missense	possibly damaging	0.50
R8870:Ano3	UTSW	2	110783729	missense	probably benign	0.12
R9071:Ano3	UTSW	2	110795073	critical splice acceptor site	probably null
R9072:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9073:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9315:Ano3	UTSW	2	110697942	missense	probably damaging	0.97
R9376:Ano3	UTSW	2	110666437	missense	probably damaging	1.00
R9588:Ano3	UTSW	2	110697997	missense	possibly damaging	0.91
R9697:Ano3	UTSW	2	110665908	missense	probably damaging	1.00
R9716:Ano3	UTSW	2	110771031	missense	probably damaging	0.97
R9748:Ano3	UTSW	2	110658295	missense	probably damaging	1.00
RF012:Ano3	UTSW	2	110697523	missense	possibly damaging	0.83
RF013:Ano3	UTSW	2	110697036	missense	probably benign	0.30
X0058:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
Z1088:Ano3	UTSW	2	110745847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCTCCCAGTTGTCCATTAAC -3'
(R):5'- GAGCCACTGACATAGGTAAGTCTC -3'

Sequencing Primer
(F):5'- CAGTTGTCCATTAACTGCAACG -3'
(R):5'- TCATGAACACTGGGTGACTC -3'

Posted On

2019-06-26