Incidental Mutation 'R7215:Macf1'
ID 561373
Institutional Source Beutler Lab
Gene Symbol Macf1
Ensembl Gene ENSMUSG00000028649
Gene Name microtubule-actin crosslinking factor 1
Synonyms trabeculin alpha, Acf7, Aclp7
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199136.1, NM_001199137.1; MGI:108559

Essential gene? Essential (E-score: 1.000) question?
Stock # R7215 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 123349633-123684360 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123507304 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 663 (T663A)
Ref Sequence ENSEMBL: ENSMUSP00000095507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106220] [ENSMUST00000106224] [ENSMUST00000147030] [ENSMUST00000147228] [ENSMUST00000151346]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082108
AA Change: T663A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649
AA Change: T663A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
SPEC 1550 1658 3.94e-3 SMART
SPEC 1818 1928 4.03e-9 SMART
SPEC 1935 2041 1.75e-9 SMART
SPEC 2048 2150 5.57e-3 SMART
SPEC 2157 2256 4.56e0 SMART
SPEC 2263 2394 3.46e-1 SMART
SPEC 2401 2506 1.29e-7 SMART
SPEC 2513 2617 1.19e-2 SMART
SPEC 2624 2727 2.7e-1 SMART
SPEC 2734 2837 4.99e-14 SMART
SPEC 2844 2944 1.9e-5 SMART
SPEC 2951 3057 2.83e0 SMART
SPEC 3060 3162 2.14e-4 SMART
SPEC 3169 3273 3.01e-8 SMART
SPEC 3280 3382 4.48e-16 SMART
SPEC 3389 3491 1.26e-10 SMART
SPEC 3498 3600 2.26e-3 SMART
SPEC 3607 3709 4.29e-4 SMART
SPEC 3716 3817 9.99e-14 SMART
SPEC 3824 3930 5.79e-2 SMART
SPEC 3937 4039 6.59e-14 SMART
SPEC 4046 4149 3.7e-17 SMART
SPEC 4156 4258 1.16e-23 SMART
SPEC 4265 4368 3.58e-15 SMART
SPEC 4375 4477 2.61e-17 SMART
SPEC 4484 4587 9.38e-19 SMART
SPEC 4594 4695 2.29e-22 SMART
SPEC 4702 4804 4.99e-14 SMART
SPEC 4811 4941 1.45e-10 SMART
EFh 4979 5007 5.08e-3 SMART
EFh 5015 5043 1.17e-2 SMART
GAS2 5054 5132 8.5e-54 SMART
low complexity region 5154 5199 N/A INTRINSIC
low complexity region 5248 5273 N/A INTRINSIC
low complexity region 5290 5302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084301
AA Change: T663A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649
AA Change: T663A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 2.8e-30 SMART
CH 196 293 3.6e-26 SMART
SPEC 317 420 2.6e-2 SMART
SPEC 583 680 2.7e-11 SMART
SPEC 683 783 3.6e-7 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 1.5e-2 SMART
SPEC 1425 1533 6.9e-10 SMART
PLEC 1530 1576 5.3e-6 SMART
PLEC 1577 1614 1.2e-2 SMART
PLEC 1616 1653 8.7e-2 SMART
PLEC 1654 1691 8.3e-2 SMART
PLEC 1695 1729 1.3e-1 SMART
PLEC 1731 1767 1.4e-4 SMART
PLEC 1768 1805 2e-12 SMART
PLEC 1808 1843 5.2e-4 SMART
PLEC 1844 1881 4e-2 SMART
PLEC 1884 1919 1.9e0 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 4.5e-6 SMART
PLEC 2347 2388 1.7e-7 SMART
PLEC 2389 2426 1.2e-5 SMART
PLEC 2447 2484 6.3e-3 SMART
PLEC 2485 2522 2.1e-4 SMART
PLEC 2523 2561 1.5e-1 SMART
PLEC 2586 2633 3.1e-1 SMART
PLEC 2671 2708 6.5e-10 SMART
PLEC 2709 2746 2.3e-3 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3683 7.1e-3 SMART
SPEC 3841 3951 2.6e-11 SMART
SPEC 3958 4064 1.1e-11 SMART
SPEC 4071 4173 3.6e-5 SMART
SPEC 4180 4279 2.9e-2 SMART
SPEC 4286 4417 2.2e-3 SMART
SPEC 4424 4529 8.2e-10 SMART
SPEC 4536 4640 7.4e-5 SMART
SPEC 4647 4750 1.7e-3 SMART
SPEC 4757 4860 3.2e-16 SMART
SPEC 4867 4967 1.2e-7 SMART
SPEC 4974 5080 1.8e-2 SMART
SPEC 5083 5185 1.3e-6 SMART
SPEC 5192 5296 2e-10 SMART
SPEC 5303 5405 2.8e-18 SMART
SPEC 5412 5514 7.7e-13 SMART
SPEC 5521 5623 1.5e-5 SMART
SPEC 5630 5732 2.7e-6 SMART
SPEC 5739 5840 6.1e-16 SMART
SPEC 5847 5953 3.6e-4 SMART
SPEC 5960 6062 4.1e-16 SMART
SPEC 6069 6172 2.4e-19 SMART
SPEC 6179 6281 7.6e-26 SMART
SPEC 6288 6391 2.2e-17 SMART
SPEC 6398 6500 1.6e-19 SMART
SPEC 6507 6610 5.7e-21 SMART
SPEC 6617 6718 1.5e-24 SMART
SPEC 6725 6827 3.2e-16 SMART
SPEC 6834 6964 9.4e-13 SMART
EFh 7002 7030 2.4e-5 SMART
EFh 7038 7066 5.8e-5 SMART
GAS2 7077 7155 5.5e-56 SMART
low complexity region 7177 7222 N/A INTRINSIC
low complexity region 7271 7296 N/A INTRINSIC
low complexity region 7313 7325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097897
AA Change: T663A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649
AA Change: T663A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4644 1.19e-2 SMART
SPEC 4651 4754 2.7e-1 SMART
SPEC 4761 4864 4.99e-14 SMART
SPEC 4871 4971 1.9e-5 SMART
SPEC 4978 5084 2.83e0 SMART
SPEC 5087 5189 2.14e-4 SMART
SPEC 5196 5300 3.01e-8 SMART
SPEC 5307 5409 4.48e-16 SMART
SPEC 5416 5518 1.26e-10 SMART
SPEC 5525 5627 2.26e-3 SMART
SPEC 5634 5736 4.29e-4 SMART
SPEC 5743 5844 9.99e-14 SMART
SPEC 5851 5957 5.79e-2 SMART
SPEC 5964 6066 6.59e-14 SMART
SPEC 6073 6176 3.7e-17 SMART
SPEC 6183 6285 1.16e-23 SMART
SPEC 6292 6395 3.58e-15 SMART
SPEC 6402 6504 2.61e-17 SMART
SPEC 6511 6614 9.38e-19 SMART
SPEC 6621 6722 2.29e-22 SMART
SPEC 6729 6831 4.99e-14 SMART
SPEC 6838 6968 1.45e-10 SMART
EFh 7006 7034 5.08e-3 SMART
EFh 7042 7070 1.17e-2 SMART
GAS2 7081 7159 8.5e-54 SMART
low complexity region 7181 7226 N/A INTRINSIC
low complexity region 7275 7300 N/A INTRINSIC
low complexity region 7317 7329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106220
AA Change: T814A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000101827
Gene: ENSMUSG00000028649
AA Change: T814A

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 5e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 1.85e-1 SMART
SPEC 1968 2078 4.03e-9 SMART
SPEC 2085 2191 1.75e-9 SMART
SPEC 2198 2300 5.57e-3 SMART
SPEC 2307 2406 4.56e0 SMART
SPEC 2413 2544 3.46e-1 SMART
SPEC 2551 2656 1.29e-7 SMART
SPEC 2663 2767 1.19e-2 SMART
SPEC 2774 2877 2.7e-1 SMART
SPEC 2884 2987 4.99e-14 SMART
SPEC 2994 3094 1.9e-5 SMART
SPEC 3101 3207 2.83e0 SMART
SPEC 3210 3312 2.14e-4 SMART
SPEC 3319 3423 3.01e-8 SMART
SPEC 3430 3532 4.48e-16 SMART
SPEC 3539 3641 1.26e-10 SMART
SPEC 3648 3750 2.26e-3 SMART
SPEC 3757 3859 4.29e-4 SMART
SPEC 3866 3967 9.99e-14 SMART
SPEC 3974 4080 5.79e-2 SMART
SPEC 4087 4189 6.59e-14 SMART
SPEC 4196 4299 3.7e-17 SMART
SPEC 4306 4408 1.16e-23 SMART
SPEC 4415 4518 3.58e-15 SMART
SPEC 4525 4627 2.61e-17 SMART
SPEC 4634 4737 9.38e-19 SMART
SPEC 4744 4845 2.29e-22 SMART
SPEC 4852 4954 4.99e-14 SMART
SPEC 4961 5091 1.45e-10 SMART
EFh 5129 5157 5.08e-3 SMART
EFh 5165 5193 1.17e-2 SMART
GAS2 5204 5282 1.59e-53 SMART
low complexity region 5304 5349 N/A INTRINSIC
low complexity region 5398 5423 N/A INTRINSIC
low complexity region 5440 5452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106224
AA Change: T663A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649
AA Change: T663A

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4642 9.34e-2 SMART
SPEC 4649 4752 2.7e-1 SMART
SPEC 4759 4862 4.99e-14 SMART
SPEC 4869 4969 1.9e-5 SMART
SPEC 4976 5082 2.83e0 SMART
SPEC 5085 5187 2.14e-4 SMART
SPEC 5194 5298 3.01e-8 SMART
SPEC 5305 5407 4.48e-16 SMART
SPEC 5414 5516 1.26e-10 SMART
SPEC 5523 5625 2.26e-3 SMART
SPEC 5632 5734 4.29e-4 SMART
SPEC 5741 5842 9.99e-14 SMART
SPEC 5849 5955 5.79e-2 SMART
SPEC 5962 6064 6.59e-14 SMART
SPEC 6071 6174 3.7e-17 SMART
SPEC 6181 6283 1.16e-23 SMART
SPEC 6290 6393 3.58e-15 SMART
SPEC 6400 6502 2.61e-17 SMART
SPEC 6509 6612 9.38e-19 SMART
SPEC 6619 6720 2.29e-22 SMART
SPEC 6727 6829 4.99e-14 SMART
SPEC 6836 6966 1.45e-10 SMART
EFh 7004 7032 5.08e-3 SMART
EFh 7040 7068 1.17e-2 SMART
GAS2 7079 7157 8.5e-54 SMART
low complexity region 7179 7224 N/A INTRINSIC
low complexity region 7273 7298 N/A INTRINSIC
low complexity region 7315 7327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147030
AA Change: T621A

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123246
Gene: ENSMUSG00000028649
AA Change: T621A

DomainStartEndE-ValueType
CH 38 137 5.63e-28 SMART
CH 154 251 7.49e-24 SMART
SPEC 275 378 4.11e0 SMART
SPEC 541 638 4.32e-9 SMART
SPEC 641 741 5.75e-5 SMART
Blast:SPEC 748 913 2e-82 BLAST
coiled coil region 1004 1025 N/A INTRINSIC
SPEC 1236 1365 2.35e0 SMART
SPEC 1383 1491 1.12e-7 SMART
SPEC 1508 1616 3.94e-3 SMART
Pfam:Spectrin 1773 1837 9.8e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147228
AA Change: T814A

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115847
Gene: ENSMUSG00000028649
AA Change: T814A

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 4e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 3.94e-3 SMART
Pfam:Spectrin 1966 2030 6.6e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151346
AA Change: T569A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114568
Gene: ENSMUSG00000028649
AA Change: T569A

DomainStartEndE-ValueType
CH 4 85 4.88e-14 SMART
CH 102 199 7.49e-24 SMART
SPEC 223 326 4.11e0 SMART
SPEC 489 586 4.32e-9 SMART
SPEC 589 689 5.75e-5 SMART
Blast:SPEC 696 861 3e-82 BLAST
coiled coil region 952 973 N/A INTRINSIC
SPEC 1184 1313 2.35e0 SMART
SPEC 1331 1439 1.12e-7 SMART
SPEC 1456 1564 3.94e-3 SMART
SPEC 1724 1834 4.03e-9 SMART
SPEC 1841 1947 1.75e-9 SMART
SPEC 1954 2056 5.57e-3 SMART
SPEC 2063 2162 4.56e0 SMART
SPEC 2169 2300 3.46e-1 SMART
SPEC 2307 2412 1.29e-7 SMART
SPEC 2419 2523 1.19e-2 SMART
SPEC 2530 2633 2.7e-1 SMART
SPEC 2640 2743 4.99e-14 SMART
SPEC 2750 2850 1.9e-5 SMART
SPEC 2857 2963 2.83e0 SMART
SPEC 2966 3068 2.14e-4 SMART
SPEC 3075 3179 3.01e-8 SMART
SPEC 3186 3288 4.48e-16 SMART
SPEC 3295 3397 4.15e-11 SMART
SPEC 3404 3506 7.07e-5 SMART
SPEC 3513 3615 2.26e-3 SMART
SPEC 3622 3724 4.29e-4 SMART
SPEC 3731 3832 9.99e-14 SMART
SPEC 3839 3945 5.79e-2 SMART
SPEC 3952 4054 6.59e-14 SMART
SPEC 4061 4164 3.7e-17 SMART
SPEC 4171 4273 1.16e-23 SMART
SPEC 4280 4383 3.58e-15 SMART
SPEC 4390 4492 2.61e-17 SMART
SPEC 4499 4602 9.38e-19 SMART
SPEC 4609 4710 2.29e-22 SMART
SPEC 4717 4819 4.99e-14 SMART
SPEC 4826 4956 1.45e-10 SMART
EFh 4990 5018 5.08e-3 SMART
EFh 5026 5054 1.17e-2 SMART
GAS2 5065 5137 2.28e-54 SMART
low complexity region 5159 5204 N/A INTRINSIC
low complexity region 5253 5278 N/A INTRINSIC
low complexity region 5295 5307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype Strain: 3652899; 4831019
Lethality: E7-E8
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Macf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Macf1 APN 4 123382122 missense probably damaging 0.99
IGL01293:Macf1 APN 4 123471311 missense probably benign 0.00
IGL01307:Macf1 APN 4 123383129 missense probably damaging 1.00
IGL01314:Macf1 APN 4 123486720 missense probably damaging 1.00
IGL01321:Macf1 APN 4 123440774 missense probably damaging 1.00
IGL01327:Macf1 APN 4 123509912 missense probably benign 0.20
IGL01365:Macf1 APN 4 123391169 missense probably damaging 1.00
IGL01465:Macf1 APN 4 123490721 missense probably benign 0.00
IGL01527:Macf1 APN 4 123493160 missense possibly damaging 0.93
IGL01533:Macf1 APN 4 123473873 missense probably damaging 1.00
IGL01539:Macf1 APN 4 123395908 splice site probably benign
IGL01543:Macf1 APN 4 123401457 missense probably damaging 1.00
IGL01553:Macf1 APN 4 123493163 nonsense probably null
IGL01558:Macf1 APN 4 123453005 missense probably benign 0.00
IGL01633:Macf1 APN 4 123502171 missense probably damaging 0.99
IGL01684:Macf1 APN 4 123465930 missense probably damaging 1.00
IGL01715:Macf1 APN 4 123391086 missense probably damaging 1.00
IGL01844:Macf1 APN 4 123440692 missense probably benign 0.34
IGL01870:Macf1 APN 4 123474113 missense probably damaging 0.99
IGL01916:Macf1 APN 4 123441630 missense probably damaging 1.00
IGL01916:Macf1 APN 4 123476037 missense probably damaging 1.00
IGL01923:Macf1 APN 4 123380444 missense possibly damaging 0.46
IGL02017:Macf1 APN 4 123499931 missense probably damaging 1.00
IGL02022:Macf1 APN 4 123391049 critical splice donor site probably null
IGL02084:Macf1 APN 4 123432603 missense probably benign 0.02
IGL02084:Macf1 APN 4 123459374 missense probably damaging 1.00
IGL02142:Macf1 APN 4 123472049 missense probably benign 0.11
IGL02151:Macf1 APN 4 123371766 splice site probably benign
IGL02164:Macf1 APN 4 123480272 missense probably benign 0.03
IGL02174:Macf1 APN 4 123491794 missense probably damaging 1.00
IGL02229:Macf1 APN 4 123509826 missense probably damaging 1.00
IGL02277:Macf1 APN 4 123486704 missense probably damaging 1.00
IGL02283:Macf1 APN 4 123471375 missense probably benign 0.01
IGL02314:Macf1 APN 4 123444837 missense probably damaging 0.99
IGL02327:Macf1 APN 4 123471730 missense probably benign 0.06
IGL02348:Macf1 APN 4 123512866 missense probably damaging 1.00
IGL02441:Macf1 APN 4 123387236 missense probably damaging 1.00
IGL02585:Macf1 APN 4 123472284 missense probably benign 0.00
IGL02602:Macf1 APN 4 123355163 missense probably damaging 1.00
IGL03204:Macf1 APN 4 123355277 splice site probably benign
anakex UTSW 4 123408271 missense probably damaging 0.97
esfuerzo UTSW 4 123476129 missense probably benign 0.22
Royal_flush UTSW 4 123365355 splice site probably null
standard UTSW 4 123486406 missense probably damaging 1.00
suspension UTSW 4 123497755 missense probably damaging 1.00
voragine UTSW 4 123355102 missense probably damaging 1.00
BB010:Macf1 UTSW 4 123409651 missense probably benign 0.00
BB020:Macf1 UTSW 4 123409651 missense probably benign 0.00
H8562:Macf1 UTSW 4 123466040 missense probably benign 0.13
IGL03052:Macf1 UTSW 4 123387395 missense probably damaging 1.00
N/A - 535:Macf1 UTSW 4 123473808 missense possibly damaging 0.82
PIT4576001:Macf1 UTSW 4 123473321 missense probably benign 0.43
R0021:Macf1 UTSW 4 123475577 missense probably damaging 1.00
R0023:Macf1 UTSW 4 123488314 splice site probably benign
R0023:Macf1 UTSW 4 123488314 splice site probably benign
R0028:Macf1 UTSW 4 123382102 missense probably damaging 1.00
R0066:Macf1 UTSW 4 123432150 nonsense probably null
R0066:Macf1 UTSW 4 123432150 nonsense probably null
R0067:Macf1 UTSW 4 123475248 missense possibly damaging 0.90
R0067:Macf1 UTSW 4 123475248 missense possibly damaging 0.90
R0078:Macf1 UTSW 4 123473868 missense probably damaging 1.00
R0106:Macf1 UTSW 4 123408564 missense probably benign 0.00
R0123:Macf1 UTSW 4 123432843 missense possibly damaging 0.78
R0129:Macf1 UTSW 4 123433275 missense probably damaging 1.00
R0134:Macf1 UTSW 4 123432843 missense possibly damaging 0.78
R0138:Macf1 UTSW 4 123440747 missense probably damaging 1.00
R0145:Macf1 UTSW 4 123387397 missense probably damaging 1.00
R0195:Macf1 UTSW 4 123434916 missense probably damaging 0.99
R0227:Macf1 UTSW 4 123399391 missense probably benign 0.14
R0233:Macf1 UTSW 4 123450127 splice site probably benign
R0254:Macf1 UTSW 4 123432779 missense probably damaging 1.00
R0357:Macf1 UTSW 4 123457983 missense probably damaging 1.00
R0398:Macf1 UTSW 4 123351017 missense probably damaging 1.00
R0413:Macf1 UTSW 4 123472269 missense probably benign
R0426:Macf1 UTSW 4 123483660 nonsense probably null
R0441:Macf1 UTSW 4 123365355 splice site probably null
R0453:Macf1 UTSW 4 123444944 missense probably benign 0.35
R0481:Macf1 UTSW 4 123484022 splice site probably null
R0502:Macf1 UTSW 4 123469815 missense probably damaging 1.00
R0503:Macf1 UTSW 4 123469815 missense probably damaging 1.00
R0519:Macf1 UTSW 4 123471320 missense probably benign 0.03
R0543:Macf1 UTSW 4 123376378 missense probably damaging 1.00
R0621:Macf1 UTSW 4 123380534 missense probably damaging 1.00
R0631:Macf1 UTSW 4 123455524 nonsense probably null
R0720:Macf1 UTSW 4 123432925 missense probably damaging 1.00
R0730:Macf1 UTSW 4 123382530 splice site probably benign
R0755:Macf1 UTSW 4 123369926 missense probably damaging 0.99
R0836:Macf1 UTSW 4 123494882 critical splice donor site probably null
R0847:Macf1 UTSW 4 123399366 missense probably benign 0.03
R0850:Macf1 UTSW 4 123474402 missense probably benign
R0924:Macf1 UTSW 4 123385478 missense probably damaging 1.00
R0973:Macf1 UTSW 4 123476000 missense possibly damaging 0.76
R1025:Macf1 UTSW 4 123473816 missense probably damaging 1.00
R1076:Macf1 UTSW 4 123385598 missense probably damaging 1.00
R1253:Macf1 UTSW 4 123457967 missense probably damaging 1.00
R1301:Macf1 UTSW 4 123486658 splice site probably benign
R1337:Macf1 UTSW 4 123476275 missense probably benign 0.34
R1344:Macf1 UTSW 4 123433453 missense probably damaging 0.99
R1404:Macf1 UTSW 4 123376516 missense probably damaging 1.00
R1404:Macf1 UTSW 4 123376516 missense probably damaging 1.00
R1443:Macf1 UTSW 4 123511007 missense probably damaging 1.00
R1452:Macf1 UTSW 4 123493998 missense probably benign
R1465:Macf1 UTSW 4 123493154 missense probably damaging 0.98
R1465:Macf1 UTSW 4 123493154 missense probably damaging 0.98
R1483:Macf1 UTSW 4 123510977 missense probably damaging 1.00
R1509:Macf1 UTSW 4 123684009 missense possibly damaging 0.92
R1510:Macf1 UTSW 4 123434762 missense probably null 1.00
R1515:Macf1 UTSW 4 123378480 missense probably damaging 1.00
R1524:Macf1 UTSW 4 123432530 missense possibly damaging 0.75
R1528:Macf1 UTSW 4 123476014 missense probably benign 0.30
R1535:Macf1 UTSW 4 123440693 missense probably benign 0.05
R1556:Macf1 UTSW 4 123455020 missense probably damaging 1.00
R1564:Macf1 UTSW 4 123459357 missense probably benign 0.00
R1586:Macf1 UTSW 4 123509846 missense probably benign 0.20
R1626:Macf1 UTSW 4 123471534 missense probably benign
R1629:Macf1 UTSW 4 123508415 nonsense probably null
R1649:Macf1 UTSW 4 123484053 missense probably damaging 0.96
R1650:Macf1 UTSW 4 123456600 nonsense probably null
R1706:Macf1 UTSW 4 123370584 critical splice donor site probably null
R1713:Macf1 UTSW 4 123378694 missense probably damaging 1.00
R1716:Macf1 UTSW 4 123401403 missense probably damaging 1.00
R1744:Macf1 UTSW 4 123475853 missense probably damaging 1.00
R1752:Macf1 UTSW 4 123483672 missense possibly damaging 0.92
R1771:Macf1 UTSW 4 123512108 missense probably damaging 1.00
R1812:Macf1 UTSW 4 123432024 missense probably damaging 1.00
R1818:Macf1 UTSW 4 123376417 missense probably damaging 1.00
R1853:Macf1 UTSW 4 123512720 splice site probably null
R1856:Macf1 UTSW 4 123369848 missense probably damaging 1.00
R1869:Macf1 UTSW 4 123351128 missense probably damaging 1.00
R1880:Macf1 UTSW 4 123438591 missense probably damaging 1.00
R1888:Macf1 UTSW 4 123455042 missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123474712 missense probably benign
R1888:Macf1 UTSW 4 123455042 missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123474712 missense probably benign
R1902:Macf1 UTSW 4 123471165 missense probably benign 0.01
R1907:Macf1 UTSW 4 123372399 missense probably damaging 1.00
R1908:Macf1 UTSW 4 123457841 missense possibly damaging 0.67
R1932:Macf1 UTSW 4 123452037 missense probably damaging 1.00
R1944:Macf1 UTSW 4 123370666 missense probably damaging 1.00
R1945:Macf1 UTSW 4 123490660 nonsense probably null
R1975:Macf1 UTSW 4 123489212 missense probably damaging 1.00
R1989:Macf1 UTSW 4 123497726 critical splice donor site probably null
R1991:Macf1 UTSW 4 123456695 missense probably damaging 1.00
R1992:Macf1 UTSW 4 123456695 missense probably damaging 1.00
R2013:Macf1 UTSW 4 123684014 missense probably damaging 1.00
R2021:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2022:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2023:Macf1 UTSW 4 123472730 missense probably damaging 1.00
R2024:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2025:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2027:Macf1 UTSW 4 123371918 missense probably damaging 1.00
R2049:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2060:Macf1 UTSW 4 123499919 splice site probably null
R2092:Macf1 UTSW 4 123383178 missense probably damaging 1.00
R2100:Macf1 UTSW 4 123397906 nonsense probably null
R2128:Macf1 UTSW 4 123492774 missense probably benign 0.11
R2129:Macf1 UTSW 4 123368815 splice site probably benign
R2140:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2142:Macf1 UTSW 4 123355102 missense probably damaging 1.00
R2182:Macf1 UTSW 4 123492671 missense probably damaging 0.98
R2185:Macf1 UTSW 4 123475556 missense probably damaging 0.99
R2190:Macf1 UTSW 4 123459212 missense probably benign 0.11
R2320:Macf1 UTSW 4 123439495 missense probably benign 0.02
R2382:Macf1 UTSW 4 123374832 missense probably damaging 1.00
R2429:Macf1 UTSW 4 123432584 missense probably damaging 0.99
R2432:Macf1 UTSW 4 123683996 missense probably damaging 1.00
R2484:Macf1 UTSW 4 123473672 missense probably damaging 1.00
R2842:Macf1 UTSW 4 123376417 missense probably damaging 1.00
R2912:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2913:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2914:Macf1 UTSW 4 123475911 missense probably damaging 1.00
R2938:Macf1 UTSW 4 123432902 missense probably damaging 0.99
R3082:Macf1 UTSW 4 123361443 splice site probably null
R3086:Macf1 UTSW 4 123435108 missense probably benign 0.00
R3408:Macf1 UTSW 4 123381781 missense probably damaging 1.00
R3499:Macf1 UTSW 4 123527305 nonsense probably null
R3696:Macf1 UTSW 4 123456362 missense probably damaging 1.00
R3716:Macf1 UTSW 4 123473502 missense probably benign 0.01
R3727:Macf1 UTSW 4 123459311 missense probably damaging 1.00
R3770:Macf1 UTSW 4 123374767 missense probably damaging 1.00
R3813:Macf1 UTSW 4 123374767 missense probably damaging 1.00
R3825:Macf1 UTSW 4 123444951 missense probably benign 0.11
R3893:Macf1 UTSW 4 123486406 missense probably damaging 1.00
R3896:Macf1 UTSW 4 123471194 missense possibly damaging 0.55
R3947:Macf1 UTSW 4 123380420 missense probably damaging 1.00
R4031:Macf1 UTSW 4 123381312 missense probably damaging 1.00
R4052:Macf1 UTSW 4 123472017 missense probably benign 0.00
R4077:Macf1 UTSW 4 123472091 missense probably benign 0.07
R4078:Macf1 UTSW 4 123472091 missense probably benign 0.07
R4084:Macf1 UTSW 4 123450072 missense probably damaging 0.98
R4094:Macf1 UTSW 4 123459269 missense probably benign 0.00
R4154:Macf1 UTSW 4 123471813 missense probably damaging 1.00
R4190:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4191:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4192:Macf1 UTSW 4 123473042 missense possibly damaging 0.95
R4232:Macf1 UTSW 4 123432392 missense probably damaging 1.00
R4299:Macf1 UTSW 4 123399406 missense probably damaging 1.00
R4326:Macf1 UTSW 4 123382212 missense probably damaging 1.00
R4327:Macf1 UTSW 4 123382212 missense probably damaging 1.00
R4355:Macf1 UTSW 4 123475091 missense possibly damaging 0.79
R4380:Macf1 UTSW 4 123354492 intron probably benign
R4422:Macf1 UTSW 4 123466046 missense probably damaging 0.96
R4436:Macf1 UTSW 4 123527342 missense probably benign 0.03
R4472:Macf1 UTSW 4 123395989 missense probably damaging 1.00
R4515:Macf1 UTSW 4 123493988 missense probably damaging 1.00
R4549:Macf1 UTSW 4 123473693 missense possibly damaging 0.75
R4621:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4622:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4623:Macf1 UTSW 4 123372348 critical splice donor site probably null
R4630:Macf1 UTSW 4 123473639 missense possibly damaging 0.84
R4647:Macf1 UTSW 4 123473627 missense probably benign 0.01
R4650:Macf1 UTSW 4 123473619 missense probably benign 0.00
R4674:Macf1 UTSW 4 123472397 missense probably benign 0.22
R4751:Macf1 UTSW 4 123471650 missense probably benign 0.01
R4762:Macf1 UTSW 4 123455444 missense probably benign 0.00
R4776:Macf1 UTSW 4 123476015 missense probably benign 0.00
R4777:Macf1 UTSW 4 123376502 missense probably damaging 1.00
R4860:Macf1 UTSW 4 123486750 missense probably damaging 1.00
R4860:Macf1 UTSW 4 123486750 missense probably damaging 1.00
R4865:Macf1 UTSW 4 123433303 missense probably damaging 1.00
R4867:Macf1 UTSW 4 123472200 missense probably damaging 0.97
R4884:Macf1 UTSW 4 123455009 missense probably benign 0.02
R4890:Macf1 UTSW 4 123448238 missense probably damaging 1.00
R4913:Macf1 UTSW 4 123499889 missense probably damaging 1.00
R4925:Macf1 UTSW 4 123526652 missense probably benign
R4948:Macf1 UTSW 4 123497755 missense probably damaging 1.00
R4958:Macf1 UTSW 4 123475364 missense probably damaging 0.99
R4986:Macf1 UTSW 4 123391121 missense probably damaging 1.00
R4999:Macf1 UTSW 4 123494909 missense probably benign 0.14
R5004:Macf1 UTSW 4 123385475 missense probably damaging 1.00
R5017:Macf1 UTSW 4 123452113 missense probably damaging 1.00
R5018:Macf1 UTSW 4 123385599 missense probably damaging 1.00
R5026:Macf1 UTSW 4 123439494 missense possibly damaging 0.95
R5037:Macf1 UTSW 4 123455519 missense probably damaging 0.97
R5039:Macf1 UTSW 4 123511220 missense probably damaging 1.00
R5041:Macf1 UTSW 4 123397046 splice site probably null
R5100:Macf1 UTSW 4 123474468 missense probably benign 0.11
R5110:Macf1 UTSW 4 123368008 missense probably damaging 0.99
R5122:Macf1 UTSW 4 123452292 missense probably damaging 1.00
R5187:Macf1 UTSW 4 123472089 missense probably benign 0.00
R5191:Macf1 UTSW 4 123472962 missense probably benign 0.00
R5201:Macf1 UTSW 4 123475945 nonsense probably null
R5236:Macf1 UTSW 4 123397821 missense probably damaging 1.00
R5248:Macf1 UTSW 4 123401774 nonsense probably null
R5251:Macf1 UTSW 4 123449967 missense probably benign 0.20
R5319:Macf1 UTSW 4 123473436 missense probably damaging 1.00
R5326:Macf1 UTSW 4 123350991 frame shift probably null
R5327:Macf1 UTSW 4 123350991 frame shift probably null
R5328:Macf1 UTSW 4 123350991 frame shift probably null
R5350:Macf1 UTSW 4 123527458 start codon destroyed probably null 0.02
R5390:Macf1 UTSW 4 123471753 missense probably damaging 0.98
R5419:Macf1 UTSW 4 123397124 missense possibly damaging 0.70
R5428:Macf1 UTSW 4 123384868 missense probably damaging 1.00
R5432:Macf1 UTSW 4 123459336 nonsense probably null
R5466:Macf1 UTSW 4 123452865 missense possibly damaging 0.75
R5472:Macf1 UTSW 4 123450061 missense probably benign
R5564:Macf1 UTSW 4 123526745 missense possibly damaging 0.92
R5566:Macf1 UTSW 4 123435164 missense probably damaging 0.98
R5597:Macf1 UTSW 4 123539777 intron probably benign
R5669:Macf1 UTSW 4 123476225 missense probably damaging 1.00
R5682:Macf1 UTSW 4 123434759 missense probably damaging 1.00
R5701:Macf1 UTSW 4 123503225 missense probably damaging 1.00
R5715:Macf1 UTSW 4 123684014 missense probably damaging 1.00
R5760:Macf1 UTSW 4 123513884 missense probably damaging 1.00
R5806:Macf1 UTSW 4 123371887 missense probably damaging 1.00
R5838:Macf1 UTSW 4 123452154 missense possibly damaging 0.95
R5839:Macf1 UTSW 4 123381324 missense probably damaging 1.00
R5850:Macf1 UTSW 4 123507306 missense probably damaging 1.00
R5875:Macf1 UTSW 4 123432314 missense possibly damaging 0.78
R5912:Macf1 UTSW 4 123397158 missense probably damaging 1.00
R5913:Macf1 UTSW 4 123476039 missense probably damaging 1.00
R5921:Macf1 UTSW 4 123526711 missense probably benign
R5940:Macf1 UTSW 4 123432881 missense probably damaging 1.00
R5950:Macf1 UTSW 4 123439436 splice site probably null
R6005:Macf1 UTSW 4 123474275 missense possibly damaging 0.82
R6029:Macf1 UTSW 4 123507333 missense probably damaging 1.00
R6041:Macf1 UTSW 4 123513848 missense probably damaging 1.00
R6057:Macf1 UTSW 4 123510743 missense probably damaging 0.98
R6156:Macf1 UTSW 4 123472280 missense probably benign 0.00
R6186:Macf1 UTSW 4 123484175 missense probably damaging 1.00
R6197:Macf1 UTSW 4 123452292 missense probably damaging 1.00
R6262:Macf1 UTSW 4 123473190 missense possibly damaging 0.79
R6296:Macf1 UTSW 4 123432875 missense probably damaging 1.00
R6340:Macf1 UTSW 4 123448249 missense probably benign 0.13
R6369:Macf1 UTSW 4 123410562 missense possibly damaging 0.90
R6414:Macf1 UTSW 4 123493195 missense possibly damaging 0.93
R6429:Macf1 UTSW 4 123401594 splice site probably null
R6501:Macf1 UTSW 4 123469632 splice site probably null
R6508:Macf1 UTSW 4 123469742 missense probably damaging 0.96
R6519:Macf1 UTSW 4 123472325 missense probably benign 0.13
R6535:Macf1 UTSW 4 123471935 missense possibly damaging 0.82
R6537:Macf1 UTSW 4 123492725 missense probably damaging 1.00
R6546:Macf1 UTSW 4 123432281 missense probably benign 0.14
R6583:Macf1 UTSW 4 123470946 splice site probably null
R6597:Macf1 UTSW 4 123382692 missense probably damaging 1.00
R6693:Macf1 UTSW 4 123473808 missense possibly damaging 0.82
R6696:Macf1 UTSW 4 123509803 missense probably damaging 1.00
R6704:Macf1 UTSW 4 123410762 intron probably benign
R6716:Macf1 UTSW 4 123508438 missense probably damaging 1.00
R6789:Macf1 UTSW 4 123372438 missense probably damaging 1.00
R6807:Macf1 UTSW 4 123374415 missense probably damaging 1.00
R6825:Macf1 UTSW 4 123383222 splice site probably null
R6881:Macf1 UTSW 4 123432453 missense probably damaging 1.00
R6894:Macf1 UTSW 4 123483687 missense possibly damaging 0.89
R6924:Macf1 UTSW 4 123527352 missense possibly damaging 0.53
R6962:Macf1 UTSW 4 123440722 missense probably benign 0.01
R6965:Macf1 UTSW 4 123408745 missense probably benign 0.38
R6969:Macf1 UTSW 4 123457800 missense probably benign 0.01
R7032:Macf1 UTSW 4 123472308 missense probably benign 0.00
R7055:Macf1 UTSW 4 123409196 missense probably benign 0.01
R7078:Macf1 UTSW 4 123432143 missense probably damaging 0.99
R7263:Macf1 UTSW 4 123378150 missense probably damaging 1.00
R7265:Macf1 UTSW 4 123407877 missense probably benign 0.00
R7278:Macf1 UTSW 4 123440743 missense possibly damaging 0.87
R7312:Macf1 UTSW 4 123506337 missense probably damaging 1.00
R7324:Macf1 UTSW 4 123374425 missense probably benign 0.09
R7334:Macf1 UTSW 4 123399442 missense probably damaging 1.00
R7342:Macf1 UTSW 4 123382124 missense probably damaging 1.00
R7409:Macf1 UTSW 4 123504470 missense probably damaging 1.00
R7436:Macf1 UTSW 4 123456643 missense probably benign
R7440:Macf1 UTSW 4 123455446 nonsense probably null
R7462:Macf1 UTSW 4 123492763 missense probably damaging 1.00
R7471:Macf1 UTSW 4 123472289 missense probably benign 0.00
R7472:Macf1 UTSW 4 123433067 missense probably benign 0.16
R7486:Macf1 UTSW 4 123409581 missense probably benign 0.00
R7492:Macf1 UTSW 4 123475731 missense possibly damaging 0.83
R7511:Macf1 UTSW 4 123473300 missense possibly damaging 0.72
R7528:Macf1 UTSW 4 123432059 missense possibly damaging 0.90
R7547:Macf1 UTSW 4 123441617 missense probably damaging 1.00
R7592:Macf1 UTSW 4 123410893 intron probably benign
R7723:Macf1 UTSW 4 123432924 missense probably benign 0.00
R7731:Macf1 UTSW 4 123444879 missense probably benign 0.19
R7739:Macf1 UTSW 4 123385598 missense probably damaging 1.00
R7740:Macf1 UTSW 4 123684303 start gained probably benign
R7798:Macf1 UTSW 4 123378100 missense probably damaging 1.00
R7799:Macf1 UTSW 4 123527113 missense probably benign 0.00
R7801:Macf1 UTSW 4 123408271 missense probably damaging 0.97
R7842:Macf1 UTSW 4 123526909 missense probably benign 0.12
R7849:Macf1 UTSW 4 123407599 missense probably benign 0.00
R7873:Macf1 UTSW 4 123504551 critical splice acceptor site probably null
R7933:Macf1 UTSW 4 123409651 missense probably benign 0.00
R7934:Macf1 UTSW 4 123473934 missense possibly damaging 0.89
R7947:Macf1 UTSW 4 123401407 missense probably damaging 0.98
R7988:Macf1 UTSW 4 123506480 missense probably damaging 1.00
R7992:Macf1 UTSW 4 123395960 missense probably damaging 1.00
R8013:Macf1 UTSW 4 123526826 missense probably benign 0.00
R8014:Macf1 UTSW 4 123526826 missense probably benign 0.00
R8029:Macf1 UTSW 4 123444892 missense possibly damaging 0.50
R8064:Macf1 UTSW 4 123459374 missense possibly damaging 0.91
R8085:Macf1 UTSW 4 123410082 missense possibly damaging 0.46
R8094:Macf1 UTSW 4 123369867 missense probably damaging 0.99
R8099:Macf1 UTSW 4 123476129 missense probably benign 0.22
R8147:Macf1 UTSW 4 123491698 missense probably damaging 1.00
R8151:Macf1 UTSW 4 123397413 missense possibly damaging 0.91
R8186:Macf1 UTSW 4 123372426 missense probably damaging 1.00
R8186:Macf1 UTSW 4 123382130 missense possibly damaging 0.89
R8192:Macf1 UTSW 4 123440597 missense probably damaging 1.00
R8196:Macf1 UTSW 4 123382704 missense probably damaging 1.00
R8260:Macf1 UTSW 4 123472070 missense probably benign
R8305:Macf1 UTSW 4 123395621 intron probably benign
R8333:Macf1 UTSW 4 123385452 splice site probably null
R8334:Macf1 UTSW 4 123432108 missense possibly damaging 0.82
R8344:Macf1 UTSW 4 123384683 missense probably damaging 1.00
R8344:Macf1 UTSW 4 123526856 missense probably benign
R8422:Macf1 UTSW 4 123409486 missense possibly damaging 0.46
R8459:Macf1 UTSW 4 123480314 missense possibly damaging 0.68
R8466:Macf1 UTSW 4 123455444 missense probably benign 0.00
R8472:Macf1 UTSW 4 123453002 missense probably damaging 1.00
R8556:Macf1 UTSW 4 123488343 missense probably damaging 1.00
R8679:Macf1 UTSW 4 123512076 missense probably benign 0.00
R8723:Macf1 UTSW 4 123455117 nonsense probably null
R8732:Macf1 UTSW 4 123509770 critical splice donor site probably null
R8747:Macf1 UTSW 4 123355151 missense probably damaging 1.00
R8748:Macf1 UTSW 4 123474275 missense probably benign 0.00
R8785:Macf1 UTSW 4 123448260 critical splice acceptor site probably null
R8826:Macf1 UTSW 4 123382229 missense probably damaging 1.00
R8828:Macf1 UTSW 4 123408411 missense probably benign 0.01
R8833:Macf1 UTSW 4 123471341 missense probably benign
R8889:Macf1 UTSW 4 123355243 missense probably damaging 1.00
R8892:Macf1 UTSW 4 123355243 missense probably damaging 1.00
R8893:Macf1 UTSW 4 123410530 missense probably benign 0.27
R8899:Macf1 UTSW 4 123475059 missense probably benign 0.00
R8956:Macf1 UTSW 4 123474848 missense probably benign
R9037:Macf1 UTSW 4 123471725 missense probably benign 0.03
R9086:Macf1 UTSW 4 123484151 missense probably damaging 1.00
R9111:Macf1 UTSW 4 123513026 missense probably damaging 1.00
R9126:Macf1 UTSW 4 123382400 missense possibly damaging 0.88
R9139:Macf1 UTSW 4 123434771 missense probably damaging 1.00
R9140:Macf1 UTSW 4 123474062 missense possibly damaging 0.92
R9149:Macf1 UTSW 4 123471533 missense probably benign 0.40
R9163:Macf1 UTSW 4 123509893 missense probably damaging 1.00
R9177:Macf1 UTSW 4 123473789 missense probably damaging 1.00
R9206:Macf1 UTSW 4 123684132 missense unknown
R9208:Macf1 UTSW 4 123684132 missense unknown
R9209:Macf1 UTSW 4 123432434 missense probably damaging 1.00
R9219:Macf1 UTSW 4 123407761 missense possibly damaging 0.81
R9224:Macf1 UTSW 4 123432897 missense probably damaging 1.00
R9241:Macf1 UTSW 4 123378159 missense probably damaging 1.00
R9268:Macf1 UTSW 4 123473789 missense probably damaging 1.00
R9276:Macf1 UTSW 4 123434708 missense probably damaging 1.00
R9296:Macf1 UTSW 4 123506453 missense probably damaging 0.99
R9369:Macf1 UTSW 4 123455357 critical splice donor site probably null
R9438:Macf1 UTSW 4 123385573 missense probably benign 0.01
R9443:Macf1 UTSW 4 123471875 missense probably benign
R9529:Macf1 UTSW 4 123513887 missense probably damaging 1.00
R9600:Macf1 UTSW 4 123471209 missense possibly damaging 0.76
R9613:Macf1 UTSW 4 123526495 missense probably benign 0.41
R9686:Macf1 UTSW 4 123483698 missense possibly damaging 0.64
R9689:Macf1 UTSW 4 123471861 missense probably benign
R9740:Macf1 UTSW 4 123372384 missense probably damaging 1.00
R9740:Macf1 UTSW 4 123473060 missense probably damaging 1.00
R9764:Macf1 UTSW 4 123472343 missense probably benign 0.02
R9779:Macf1 UTSW 4 123454996 missense probably benign 0.02
RF011:Macf1 UTSW 4 123473855 missense probably damaging 1.00
X0022:Macf1 UTSW 4 123450042 missense probably damaging 0.99
X0027:Macf1 UTSW 4 123503269 missense probably damaging 1.00
X0064:Macf1 UTSW 4 123511874 missense probably damaging 1.00
Z1177:Macf1 UTSW 4 123471475 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTATGTGGGGAGATAATGCC -3'
(R):5'- AATTGTTGTCCACTCCGTGC -3'

Sequencing Primer
(F):5'- CCCAAATCATGTGCTTTCTG -3'
(R):5'- GATCTAGAACCTAGTTGTCCAGGC -3'
Posted On 2019-06-26