Incidental Mutation 'R7215:Atg9b'
ID 561375
Institutional Source Beutler Lab
Gene Symbol Atg9b
Ensembl Gene ENSMUSG00000038295
Gene Name autophagy related 9B
Synonyms Nos3as, Apg9l2, LOC213948, eONE
MMRRC Submission 045287-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7215 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 24589179-24597141 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 24593039 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Glycine at position 455 (W455G)
Ref Sequence ENSEMBL: ENSMUSP00000051864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000059401] [ENSMUST00000115090]
AlphaFold Q6EBV9
Predicted Effect probably benign
Transcript: ENSMUST00000030834
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059401
AA Change: W455G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051864
Gene: ENSMUSG00000038295
AA Change: W455G

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
transmembrane domain 279 296 N/A INTRINSIC
Pfam:APG9 321 681 1.2e-100 PFAM
low complexity region 782 799 N/A INTRINSIC
low complexity region 838 847 N/A INTRINSIC
low complexity region 854 871 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115090
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,471,690 (GRCm39) V1032M possibly damaging Het
Abca13 T A 11: 9,238,405 (GRCm39) probably null Het
Adamts14 T A 10: 61,047,375 (GRCm39) H739L possibly damaging Het
Adgrl3 A G 5: 81,841,397 (GRCm39) E758G probably damaging Het
Ano3 T A 2: 110,496,277 (GRCm39) T826S probably damaging Het
Arhgap45 C T 10: 79,861,316 (GRCm39) T493I possibly damaging Het
Atp4a A G 7: 30,416,785 (GRCm39) N496S possibly damaging Het
Bckdk T A 7: 127,504,282 (GRCm39) D60E possibly damaging Het
Blmh A T 11: 76,856,725 (GRCm39) K244* probably null Het
Btbd17 T C 11: 114,682,291 (GRCm39) I474V possibly damaging Het
C87436 A G 6: 86,439,662 (GRCm39) E451G possibly damaging Het
Camta1 T C 4: 151,229,194 (GRCm39) E546G probably damaging Het
Casp1 A G 9: 5,298,523 (GRCm39) probably null Het
Ccdc116 A G 16: 16,957,792 (GRCm39) Y456H probably damaging Het
Cep350 A C 1: 155,770,453 (GRCm39) S1812R possibly damaging Het
Chrna10 A G 7: 101,761,415 (GRCm39) L392P possibly damaging Het
Col22a1 A T 15: 71,842,181 (GRCm39) C434* probably null Het
Cxcl9 G A 5: 92,471,747 (GRCm39) Q98* probably null Het
Cyp2c54 G A 19: 40,034,626 (GRCm39) T348I probably damaging Het
Dnah7a G A 1: 53,657,509 (GRCm39) R756C probably damaging Het
Dnajc18 T C 18: 35,815,034 (GRCm39) T239A probably benign Het
Dnase2a A T 8: 85,636,399 (GRCm39) probably null Het
Dpyd A G 3: 119,059,681 (GRCm39) T793A probably benign Het
Edil3 T C 13: 88,970,169 (GRCm39) probably null Het
Ehd1 T A 19: 6,347,672 (GRCm39) I342N possibly damaging Het
Erbb4 A T 1: 68,378,619 (GRCm39) S341T probably benign Het
Ezh1 T A 11: 101,106,125 (GRCm39) T87S probably benign Het
Fam20b A T 1: 156,518,123 (GRCm39) W224R probably damaging Het
Galns A T 8: 123,326,087 (GRCm39) probably null Het
Gm13283 C T 4: 88,678,967 (GRCm39) probably benign Het
Gm49342 A T 14: 51,182,040 (GRCm39) M23L probably benign Het
Gm5114 T A 7: 39,060,795 (GRCm39) H18L probably benign Het
Gpr89 A G 3: 96,787,404 (GRCm39) W299R probably damaging Het
Hadha G T 5: 30,324,840 (GRCm39) N755K probably benign Het
Inpp5d A T 1: 87,628,940 (GRCm39) H620L probably benign Het
Klk1b3 T A 7: 43,849,828 (GRCm39) probably null Het
Macf1 T C 4: 123,401,097 (GRCm39) T663A probably damaging Het
Man1b1 A G 2: 25,240,402 (GRCm39) N601S probably benign Het
Mbtps1 A G 8: 120,251,307 (GRCm39) V605A possibly damaging Het
Med23 C G 10: 24,764,327 (GRCm39) D311E probably benign Het
Myo3a G T 2: 22,250,378 (GRCm39) D82Y possibly damaging Het
Nsd1 T A 13: 55,395,454 (GRCm39) D1121E probably benign Het
Odad1 C T 7: 45,586,046 (GRCm39) R148C probably damaging Het
Or4c116 G A 2: 88,942,845 (GRCm39) Q4* probably null Het
Or5al1 C T 2: 85,989,800 (GRCm39) V305I probably benign Het
Or8b3b A G 9: 38,584,743 (GRCm39) I12T probably benign Het
Otoa T C 7: 120,717,795 (GRCm39) V19A unknown Het
Pcdhb20 A T 18: 37,638,439 (GRCm39) T322S probably benign Het
Pecam1 T C 11: 106,586,745 (GRCm39) T257A probably benign Het
Pi16 G T 17: 29,538,072 (GRCm39) probably benign Het
Pik3c2g C T 6: 139,700,589 (GRCm39) T293M Het
Pira13 C T 7: 3,825,310 (GRCm39) C444Y unknown Het
Pkhd1l1 T A 15: 44,391,559 (GRCm39) C1542S possibly damaging Het
Prrc2b G A 2: 32,119,309 (GRCm39) G2172R probably damaging Het
Prrt1 A T 17: 34,848,677 (GRCm39) probably null Het
Ptprb T A 10: 116,174,681 (GRCm39) N784K possibly damaging Het
Rem1 C A 2: 152,470,069 (GRCm39) S18R probably damaging Het
Ripk4 G A 16: 97,548,523 (GRCm39) probably null Het
Scn8a G A 15: 100,927,711 (GRCm39) V1397I possibly damaging Het
Setbp1 T A 18: 78,900,052 (GRCm39) H1205L probably damaging Het
Shmt1 T C 11: 60,692,361 (GRCm39) I132V probably damaging Het
Slc24a1 T A 9: 64,835,785 (GRCm39) T781S unknown Het
Sncaip C T 18: 53,040,415 (GRCm39) Q870* probably null Het
Stab1 A T 14: 30,882,754 (GRCm39) N416K possibly damaging Het
Tcea1 A G 1: 4,937,706 (GRCm39) D26G probably damaging Het
Tcf20 A T 15: 82,737,690 (GRCm39) S1254T probably benign Het
Tead4 T A 6: 128,205,641 (GRCm39) I354F probably damaging Het
Tex36 G A 7: 133,189,147 (GRCm39) R142* probably null Het
Trav6d-3 T A 14: 52,962,799 (GRCm39) L12Q probably damaging Het
Trpc4 A G 3: 54,102,317 (GRCm39) T72A possibly damaging Het
Trrap G A 5: 144,733,945 (GRCm39) A933T probably benign Het
Tspoap1 T A 11: 87,661,315 (GRCm39) I589N probably benign Het
Ttll5 T A 12: 85,980,170 (GRCm39) V918E probably benign Het
Tut4 T C 4: 108,384,205 (GRCm39) Y1091H probably damaging Het
Txn2 A G 15: 77,811,886 (GRCm39) probably null Het
Ucn3 T G 13: 3,991,365 (GRCm39) T96P probably benign Het
Usp36 T C 11: 118,155,980 (GRCm39) E764G possibly damaging Het
Vmn2r23 A T 6: 123,681,323 (GRCm39) H77L probably benign Het
Vmn2r57 T C 7: 41,049,710 (GRCm39) T680A probably benign Het
Vwa3a T C 7: 120,394,853 (GRCm39) I891T possibly damaging Het
Zfp764l1 A G 7: 126,990,695 (GRCm39) S431P probably benign Het
Zhx2 A G 15: 57,687,039 (GRCm39) I803V probably benign Het
Other mutations in Atg9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Atg9b APN 5 24,591,513 (GRCm39) splice site probably null
IGL02020:Atg9b APN 5 24,596,056 (GRCm39) missense possibly damaging 0.89
PIT4418001:Atg9b UTSW 5 24,590,513 (GRCm39) missense possibly damaging 0.93
R0045:Atg9b UTSW 5 24,592,396 (GRCm39) missense probably damaging 0.99
R1698:Atg9b UTSW 5 24,593,186 (GRCm39) missense probably damaging 1.00
R1807:Atg9b UTSW 5 24,592,055 (GRCm39) missense probably damaging 1.00
R1885:Atg9b UTSW 5 24,593,252 (GRCm39) missense probably damaging 1.00
R2183:Atg9b UTSW 5 24,595,491 (GRCm39) missense probably benign 0.01
R2224:Atg9b UTSW 5 24,591,393 (GRCm39) missense possibly damaging 0.77
R2226:Atg9b UTSW 5 24,591,393 (GRCm39) missense possibly damaging 0.77
R2227:Atg9b UTSW 5 24,591,393 (GRCm39) missense possibly damaging 0.77
R2426:Atg9b UTSW 5 24,591,992 (GRCm39) missense probably damaging 1.00
R2919:Atg9b UTSW 5 24,596,542 (GRCm39) missense possibly damaging 0.66
R3003:Atg9b UTSW 5 24,596,217 (GRCm39) missense probably damaging 1.00
R4772:Atg9b UTSW 5 24,590,237 (GRCm39) makesense probably null
R4786:Atg9b UTSW 5 24,591,087 (GRCm39) missense possibly damaging 0.92
R5901:Atg9b UTSW 5 24,597,017 (GRCm39) unclassified probably benign
R6410:Atg9b UTSW 5 24,591,108 (GRCm39) missense possibly damaging 0.46
R6505:Atg9b UTSW 5 24,595,575 (GRCm39) missense probably damaging 1.00
R8134:Atg9b UTSW 5 24,590,220 (GRCm39) critical splice donor site probably null
R8219:Atg9b UTSW 5 24,591,330 (GRCm39) missense probably damaging 1.00
R8257:Atg9b UTSW 5 24,591,303 (GRCm39) unclassified probably benign
R8460:Atg9b UTSW 5 24,591,966 (GRCm39) missense probably damaging 0.97
R8671:Atg9b UTSW 5 24,591,107 (GRCm39) missense probably benign 0.08
R8774:Atg9b UTSW 5 24,595,571 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Atg9b UTSW 5 24,595,571 (GRCm39) missense probably damaging 1.00
R8870:Atg9b UTSW 5 24,592,032 (GRCm39) missense probably damaging 1.00
R8956:Atg9b UTSW 5 24,591,850 (GRCm39) unclassified probably benign
R8966:Atg9b UTSW 5 24,596,200 (GRCm39) critical splice donor site probably null
R8969:Atg9b UTSW 5 24,592,832 (GRCm39) missense probably benign 0.00
R9521:Atg9b UTSW 5 24,593,107 (GRCm39) missense probably benign
R9638:Atg9b UTSW 5 24,596,406 (GRCm39) missense possibly damaging 0.67
Z1177:Atg9b UTSW 5 24,596,785 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGATGGTGAGCACTAGCAGC -3'
(R):5'- AACGTGGACTTGCTGCTCTTC -3'

Sequencing Primer
(F):5'- TCCCGAGAAGAAGACCAGCTG -3'
(R):5'- GCTGCTCTTCCGCGGTC -3'
Posted On 2019-06-26