Incidental Mutation 'R7215:Hadha'
ID561376
Institutional Source Beutler Lab
Gene Symbol Hadha
Ensembl Gene ENSMUSG00000025745
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit
SynonymsMtpa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7215 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30118304-30155162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30119842 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 755 (N755K)
Ref Sequence ENSEMBL: ENSMUSP00000120976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058045] [ENSMUST00000156859]
Predicted Effect probably benign
Transcript: ENSMUST00000058045
SMART Domains Protein: ENSMUSP00000054208
Gene: ENSMUSG00000044576

DomainStartEndE-ValueType
Pfam:CABIT 29 337 1.2e-77 PFAM
low complexity region 379 405 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 524 534 N/A INTRINSIC
low complexity region 538 553 N/A INTRINSIC
low complexity region 569 588 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 686 696 N/A INTRINSIC
PDB:2DKZ|A 794 878 3e-30 PDB
Blast:SAM 812 879 6e-35 BLAST
SCOP:d1kw4a_ 816 877 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156859
AA Change: N755K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120976
Gene: ENSMUSG00000025745
AA Change: N755K

DomainStartEndE-ValueType
Pfam:ECH_1 44 297 3.6e-42 PFAM
Pfam:ECH_2 49 225 8.6e-27 PFAM
Pfam:3HCDH_N 363 542 1e-54 PFAM
Pfam:3HCDH 544 639 7.7e-29 PFAM
low complexity region 706 720 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the alpha subunit catalyzing the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities. Mutations in this gene result in trifunctional protein deficiency or LCHAD deficiency. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within 36 hours with hypoglycemia and liver steatosis. Liver steatosis and insulin resistance develop in heterozygotes with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Hadha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Hadha APN 5 30120147 missense possibly damaging 0.94
IGL00435:Hadha APN 5 30122173 missense probably benign 0.12
IGL01413:Hadha APN 5 30141027 missense probably benign 0.01
IGL01715:Hadha APN 5 30120084 missense probably damaging 1.00
IGL02065:Hadha APN 5 30142845 splice site probably benign
IGL02316:Hadha APN 5 30126567 missense probably benign 0.04
IGL02366:Hadha APN 5 30135050 missense probably benign 0.01
IGL02453:Hadha APN 5 30144306 splice site probably benign
IGL02611:Hadha APN 5 30128943 splice site probably benign
IGL03127:Hadha APN 5 30134186 splice site probably benign
IGL03181:Hadha APN 5 30121526 missense probably benign 0.20
R1381:Hadha UTSW 5 30128836 missense probably benign
R1501:Hadha UTSW 5 30128806 missense probably benign 0.02
R2060:Hadha UTSW 5 30128836 missense probably benign 0.30
R3764:Hadha UTSW 5 30144209 missense probably damaging 1.00
R3778:Hadha UTSW 5 30120129 missense probably damaging 0.98
R5025:Hadha UTSW 5 30154961 unclassified probably benign
R5523:Hadha UTSW 5 30145254 missense possibly damaging 0.78
R5870:Hadha UTSW 5 30144286 missense possibly damaging 0.61
R6054:Hadha UTSW 5 30123684 missense probably benign 0.00
R6144:Hadha UTSW 5 30140996 missense probably benign 0.04
R6245:Hadha UTSW 5 30120044 critical splice donor site probably null
R6495:Hadha UTSW 5 30120050 missense probably benign 0.03
R6862:Hadha UTSW 5 30147979 critical splice donor site probably null
R7038:Hadha UTSW 5 30120000 intron probably null
R7200:Hadha UTSW 5 30145317 missense probably benign 0.25
R7267:Hadha UTSW 5 30122757 missense probably damaging 1.00
R7414:Hadha UTSW 5 30126612 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGAAGGCACTCTGATGGAG -3'
(R):5'- ACATCGGAGCTGTCTTTGG -3'

Sequencing Primer
(F):5'- CACTCTGATGGAGGAGCAAGCC -3'
(R):5'- CCCTTGTCTCGGAGGTCAGTG -3'
Posted On2019-06-26