Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Trrap'

561379

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144767732-144859778 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 144797135 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 933 (A933T)

Ref Sequence

ENSEMBL: ENSMUSP00000098035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000038980
AA Change: A933T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: A933T

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094120
AA Change: A933T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: A933T

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100467
AA Change: A933T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: A933T

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: A647T

Domain	Start	End	E-Value	Type
low complexity region	197	242	N/A	INTRINSIC
low complexity region	244	255	N/A	INTRINSIC
SCOP:d1gw5a_	474	1003	9e-7	SMART
Blast:PI3Kc	480	579	1e-13	BLAST
low complexity region	1083	1092	N/A	INTRINSIC
low complexity region	1572	1583	N/A	INTRINSIC
low complexity region	1606	1621	N/A	INTRINSIC
low complexity region	2029	2043	N/A	INTRINSIC
Pfam:FAT	2570	2914	1.5e-69	PFAM
low complexity region	3121	3134	N/A	INTRINSIC
low complexity region	3165	3176	N/A	INTRINSIC
PI3Kc	3267	3556	5.11e-8	SMART
FATC	3555	3587	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213013
AA Change: A934T

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144779974	splice site	probably benign
IGL00470:Trrap	APN	5	144818038	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144825225	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144784255	splice site	probably benign
IGL01087:Trrap	APN	5	144846539	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144804818	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144830969	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144831021	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144833287	splice site	probably benign
IGL01748:Trrap	APN	5	144833340	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144821875	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144856989	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144828494	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144816433	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144840436	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144832538	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144777917	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144798390	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144824550	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144841079	splice site	probably benign
IGL02953:Trrap	APN	5	144815964	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144833186	missense	probably benign	0.00
Buffer	UTSW	5	144834204	missense	probably benign	0.06
Card-tower	UTSW	5	144804766	missense	probably damaging	1.00
Cookie	UTSW	5	144794049	missense	probably damaging	1.00
Glass_house	UTSW	5	144845477	missense	possibly damaging	0.67
Immovable	UTSW	5	144790855	missense	possibly damaging	0.66
R5049_trrap_520	UTSW	5	144826717	missense	probably damaging	1.00
R7167_Trrap_977	UTSW	5	144839614	missense	probably benign	0.39
vitreous	UTSW	5	144805727	missense	probably damaging	1.00
PIT4243001:Trrap	UTSW	5	144796971	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144828600	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0062:Trrap	UTSW	5	144782193	splice site	probably benign
R0112:Trrap	UTSW	5	144822761	nonsense	probably null
R0126:Trrap	UTSW	5	144805750	nonsense	probably null
R0257:Trrap	UTSW	5	144804235	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144816395	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144816339	missense	probably benign	0.03
R0396:Trrap	UTSW	5	144814556	missense	probably damaging	0.99
R0448:Trrap	UTSW	5	144839567	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144846477	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144853499	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144814830	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144805727	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144804766	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144777939	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144816409	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144789599	splice site	probably benign
R1374:Trrap	UTSW	5	144846618	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144857422	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144818313	missense	probably benign
R1538:Trrap	UTSW	5	144837202	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144814575	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144828590	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144822703	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144853586	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144830951	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144815917	splice site	probably null
R1902:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144816053	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144853488	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144803044	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144828562	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144782239	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144825874	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R2174:Trrap	UTSW	5	144821855	missense	probably benign	0.40
R2442:Trrap	UTSW	5	144817966	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144843369	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144792252	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144792165	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144843318	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144831048	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144825321	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144792118	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144785480	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144816570	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144803277	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144832488	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144800948	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144845592	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144805735	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144805720	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144856960	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144826717	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144851179	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144817786	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144813503	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144844224	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144849977	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144782265	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144830945	missense	probably benign
R5885:Trrap	UTSW	5	144794793	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144849920	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144786708	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144807391	splice site	silent
R5992:Trrap	UTSW	5	144810184	missense	probably benign	0.00
R6017:Trrap	UTSW	5	144844241	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144817679	missense	possibly damaging	0.94
R6029:Trrap	UTSW	5	144825914	missense	possibly damaging	0.75
R6117:Trrap	UTSW	5	144802961	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144781981	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144839713	splice site	probably null
R6288:Trrap	UTSW	5	144811992	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144805018	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144813526	missense	probably benign	0.02
R6398:Trrap	UTSW	5	144790870	missense	possibly damaging	0.83
R6413:Trrap	UTSW	5	144784046	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144857002	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144834204	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144815550	critical splice donor site	probably null
R6631:Trrap	UTSW	5	144771650	missense	possibly damaging	0.94
R6727:Trrap	UTSW	5	144856950	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144851256	nonsense	probably null
R6914:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144784043	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144790855	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144792154	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144797135	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144803178	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144821803	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144839614	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144794049	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144842707	missense	possibly damaging	0.94
R7255:Trrap	UTSW	5	144858954	missense	probably damaging	1.00
R7261:Trrap	UTSW	5	144845477	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144814523	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144789398	missense	probably benign
R7447:Trrap	UTSW	5	144839474	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144851209	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144842612	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144832511	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144777146	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144835897	splice site	probably null
R8183:Trrap	UTSW	5	144828533	missense	probably benign	0.01
R8265:Trrap	UTSW	5	144785534	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144791165	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144825937	missense	probably benign	0.44
R8674:Trrap	UTSW	5	144791032	missense	probably benign	0.02
R8777:Trrap	UTSW	5	144837139	missense	probably benign	0.10
R8777-TAIL:Trrap	UTSW	5	144837139	missense	probably benign	0.10
R8817:Trrap	UTSW	5	144845538	missense	probably damaging	1.00
R8841:Trrap	UTSW	5	144844211	missense	probably damaging	1.00
R8871:Trrap	UTSW	5	144821839	missense	probably benign	0.30
R8937:Trrap	UTSW	5	144820253	missense	probably damaging	1.00
R8966:Trrap	UTSW	5	144803352	missense	probably damaging	0.96
R9010:Trrap	UTSW	5	144846416	missense	probably damaging	1.00
R9095:Trrap	UTSW	5	144797151	missense	probably damaging	1.00
R9127:Trrap	UTSW	5	144831020	missense	probably benign	0.16
R9132:Trrap	UTSW	5	144789552	missense	probably benign	0.03
R9224:Trrap	UTSW	5	144771239	missense	possibly damaging	0.70
R9338:Trrap	UTSW	5	144791115	missense	probably benign
R9380:Trrap	UTSW	5	144833171	missense	probably benign
R9404:Trrap	UTSW	5	144815415	missense	possibly damaging	0.85
R9457:Trrap	UTSW	5	144826668	missense	probably damaging	1.00
R9464:Trrap	UTSW	5	144826707	missense	probably damaging	0.99
R9504:Trrap	UTSW	5	144806094	missense	probably damaging	1.00
R9583:Trrap	UTSW	5	144840520	missense	probably damaging	1.00
R9584:Trrap	UTSW	5	144840520	missense	probably damaging	1.00
R9585:Trrap	UTSW	5	144840520	missense	probably damaging	1.00
R9608:Trrap	UTSW	5	144843318	missense	possibly damaging	0.60
R9728:Trrap	UTSW	5	144789383	missense	probably benign	0.22
R9782:Trrap	UTSW	5	144821906	missense	probably damaging	0.99
X0060:Trrap	UTSW	5	144843361	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144834197	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144810344	missense
Z1177:Trrap	UTSW	5	144819708	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144856951	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTTGGTGAAAGCCAGTTG -3'
(R):5'- ACTCCTGGATAACACCCTGC -3'

Sequencing Primer
(F):5'- TTTTTAGGCTTTGTGGCGCAC -3'
(R):5'- TGGATAACACCCTGCCACAG -3'

Posted On

2019-06-26