Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Mbtps1'

561395

Institutional Source

Beutler Lab

Gene Symbol

Mbtps1

Ensembl Gene

ENSMUSG00000031835

Gene Name

membrane-bound transcription factor peptidase, site 1

Synonyms

subtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik

MMRRC Submission

Accession Numbers

ENSMUST00000098362; MGI: 1927235

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119508156-119558735 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119524568 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 605 (V605A)

Ref Sequence

ENSEMBL: ENSMUSP00000080117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]

AlphaFold

Q9WTZ2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081381
AA Change: V605A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835
AA Change: V605A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S8	209	464	1.5e-43	PFAM
transmembrane domain	1000	1022	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098362
AA Change: V605A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835
AA Change: V605A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S8	213	473	3.7e-45	PFAM
transmembrane domain	1000	1022	N/A	INTRINSIC

Meta Mutation Damage Score

0.4106

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Mbtps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Muskrat	UTSW	8	119538137	missense	probably damaging	1.00
packrat	UTSW	8	119528961	missense	probably damaging	1.00
woodrat	UTSW	8	119529030	missense	probably damaging	1.00
R0194:Mbtps1	UTSW	8	119535369	missense	probably damaging	1.00
R0270:Mbtps1	UTSW	8	119538117	splice site	probably benign
R0485:Mbtps1	UTSW	8	119522601	splice site	probably benign
R1269:Mbtps1	UTSW	8	119520277	missense	probably damaging	1.00
R1351:Mbtps1	UTSW	8	119518162	missense	possibly damaging	0.95
R1536:Mbtps1	UTSW	8	119546125	missense	probably benign	0.01
R1542:Mbtps1	UTSW	8	119546247	splice site	probably null
R1543:Mbtps1	UTSW	8	119542069	splice site	probably benign
R1580:Mbtps1	UTSW	8	119538900	missense	possibly damaging	0.79
R1587:Mbtps1	UTSW	8	119518219	missense	probably damaging	0.96
R1715:Mbtps1	UTSW	8	119542730	missense	probably benign	0.40
R1845:Mbtps1	UTSW	8	119522493	missense	probably benign	0.13
R2147:Mbtps1	UTSW	8	119538859	missense	probably benign	0.01
R2157:Mbtps1	UTSW	8	119542727	missense	probably benign	0.01
R2416:Mbtps1	UTSW	8	119538917	missense	probably damaging	1.00
R2910:Mbtps1	UTSW	8	119546037	missense	possibly damaging	0.82
R2911:Mbtps1	UTSW	8	119546037	missense	possibly damaging	0.82
R3079:Mbtps1	UTSW	8	119531205	missense	probably benign	0.40
R3079:Mbtps1	UTSW	8	119538863	missense	probably damaging	1.00
R3080:Mbtps1	UTSW	8	119531205	missense	probably benign	0.40
R3080:Mbtps1	UTSW	8	119538863	missense	probably damaging	1.00
R4116:Mbtps1	UTSW	8	119541652	missense	probably benign	0.00
R4296:Mbtps1	UTSW	8	119522499	missense	possibly damaging	0.95
R4602:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4603:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4610:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4611:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4729:Mbtps1	UTSW	8	119525420	missense	probably damaging	1.00
R4868:Mbtps1	UTSW	8	119508928	missense	probably benign	0.01
R4893:Mbtps1	UTSW	8	119518193	missense	probably damaging	1.00
R4999:Mbtps1	UTSW	8	119533348	missense	probably damaging	1.00
R6056:Mbtps1	UTSW	8	119515602	missense	probably benign
R6062:Mbtps1	UTSW	8	119531091	missense	possibly damaging	0.94
R6237:Mbtps1	UTSW	8	119528961	missense	probably damaging	1.00
R6617:Mbtps1	UTSW	8	119538137	missense	probably damaging	1.00
R7275:Mbtps1	UTSW	8	119542750	missense	probably benign
R7794:Mbtps1	UTSW	8	119538884	missense	probably damaging	1.00
R8029:Mbtps1	UTSW	8	119547805	start gained	probably benign
R8104:Mbtps1	UTSW	8	119529055	missense	possibly damaging	0.85
R8205:Mbtps1	UTSW	8	119520338	missense	probably damaging	1.00
R8351:Mbtps1	UTSW	8	119546184	missense	probably benign	0.01
R8487:Mbtps1	UTSW	8	119541674	missense	probably damaging	1.00
R8753:Mbtps1	UTSW	8	119508862	missense	possibly damaging	0.94
R9155:Mbtps1	UTSW	8	119508954	missense	probably benign	0.06
R9168:Mbtps1	UTSW	8	119521863	missense	probably benign	0.01
R9172:Mbtps1	UTSW	8	119533369	missense	probably damaging	1.00
R9621:Mbtps1	UTSW	8	119508882	missense	possibly damaging	0.69
RF019:Mbtps1	UTSW	8	119525550	missense	probably damaging	1.00
X0017:Mbtps1	UTSW	8	119531124	missense	probably damaging	1.00
X0027:Mbtps1	UTSW	8	119522547	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTCATCACAACACAGGCTC -3'
(R):5'- TGGAATCCATACCCTGAGTTTG -3'

Sequencing Primer
(F):5'- TCCCAACAGTGCCAGGAG -3'
(R):5'- GGAATCCATACCCTGAGTTTGATATC -3'

Posted On

2019-06-26