Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Adamts14'

561399

Institutional Source

Beutler Lab

Gene Symbol

Adamts14

Ensembl Gene

ENSMUSG00000059901

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14

Synonyms

Adamts-14, TS14

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61197112-61273438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61211596 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 739 (H739L)

Ref Sequence

ENSEMBL: ENSMUSP00000090143 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]

AlphaFold

E9PX39

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092486
AA Change: H739L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: H739L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Pep_M12B_propep	38	194	6.3e-30	PFAM
Pfam:Reprolysin_5	245	424	6e-17	PFAM
Pfam:Reprolysin_4	246	432	2.5e-7	PFAM
Pfam:Reprolysin	246	447	1.9e-21	PFAM
Pfam:Reprolysin_2	264	437	9.2e-10	PFAM
Pfam:Reprolysin_3	268	396	2.5e-12	PFAM
TSP1	542	594	5.9e-16	SMART
Pfam:ADAM_spacer1	701	816	1.8e-24	PFAM
TSP1	837	894	2.1e-2	SMART
TSP1	897	956	3.42e-3	SMART
TSP1	959	1009	4.48e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120336
AA Change: H742L

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: H742L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	194	1.6e-38	PFAM
Pfam:Reprolysin_5	245	427	5.9e-16	PFAM
Pfam:Reprolysin_4	246	435	1.1e-7	PFAM
Pfam:Reprolysin	246	450	3.2e-20	PFAM
Pfam:Reprolysin_2	264	441	5.5e-12	PFAM
Pfam:Reprolysin_3	268	399	1.5e-13	PFAM
TSP1	545	597	5.9e-16	SMART
Pfam:ADAM_spacer1	704	819	8e-25	PFAM
TSP1	840	897	2.1e-2	SMART
TSP1	900	959	3.42e-3	SMART
TSP1	962	1012	4.48e-7	SMART

Meta Mutation Damage Score

0.6468

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Adamts14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Adamts14	APN	10	61229676	missense	probably damaging	1.00
IGL00800:Adamts14	APN	10	61205418	missense	probably benign	0.00
IGL01021:Adamts14	APN	10	61225373	missense	probably damaging	0.99
IGL01022:Adamts14	APN	10	61202942	missense	probably benign	0.01
IGL01335:Adamts14	APN	10	61198681	missense	possibly damaging	0.90
IGL01419:Adamts14	APN	10	61205542	splice site	probably benign
IGL01595:Adamts14	APN	10	61205473	missense	probably damaging	1.00
R0594:Adamts14	UTSW	10	61202887	missense	probably damaging	1.00
R0629:Adamts14	UTSW	10	61211624	nonsense	probably null
R1459:Adamts14	UTSW	10	61198804	missense	probably benign	0.13
R1565:Adamts14	UTSW	10	61270897	missense	probably damaging	1.00
R1686:Adamts14	UTSW	10	61198660	missense	probably benign
R1792:Adamts14	UTSW	10	61218498	missense	probably benign	0.07
R1876:Adamts14	UTSW	10	61200372	missense	probably benign	0.03
R1992:Adamts14	UTSW	10	61198660	missense	probably benign
R2064:Adamts14	UTSW	10	61205522	missense	probably benign	0.24
R2495:Adamts14	UTSW	10	61198970	splice site	probably null
R2848:Adamts14	UTSW	10	61218435	missense	probably damaging	1.00
R2897:Adamts14	UTSW	10	61204910	missense	probably damaging	0.99
R3428:Adamts14	UTSW	10	61224374	missense	probably benign	0.36
R4006:Adamts14	UTSW	10	61202821	critical splice donor site	probably null
R5129:Adamts14	UTSW	10	61249618	missense	probably benign	0.02
R5327:Adamts14	UTSW	10	61198488	missense	probably benign	0.01
R5524:Adamts14	UTSW	10	61230443	missense	probably damaging	1.00
R5594:Adamts14	UTSW	10	61227101	splice site	probably null
R5694:Adamts14	UTSW	10	61229652	missense	probably benign	0.45
R5801:Adamts14	UTSW	10	61202996	missense	probably damaging	0.99
R5941:Adamts14	UTSW	10	61221895	missense	probably damaging	1.00
R5953:Adamts14	UTSW	10	61207446	missense	probably damaging	0.99
R6778:Adamts14	UTSW	10	61225452	missense	probably damaging	1.00
R7169:Adamts14	UTSW	10	61204928	missense	probably damaging	0.97
R7337:Adamts14	UTSW	10	61207460	missense	probably damaging	0.98
R7511:Adamts14	UTSW	10	61218528	missense	possibly damaging	0.74
R7640:Adamts14	UTSW	10	61246057	missense	probably benign	0.00
R7798:Adamts14	UTSW	10	61271173	missense	probably damaging	0.99
R7902:Adamts14	UTSW	10	61205397	missense	possibly damaging	0.92
R8062:Adamts14	UTSW	10	61200361	critical splice donor site	probably null
R8284:Adamts14	UTSW	10	61198659	missense	possibly damaging	0.55
R8319:Adamts14	UTSW	10	61221927	missense	probably benign
R8475:Adamts14	UTSW	10	61202887	missense	probably damaging	1.00
R8494:Adamts14	UTSW	10	61202929	missense	probably benign	0.03
R8519:Adamts14	UTSW	10	61202840	missense	possibly damaging	0.84
R8547:Adamts14	UTSW	10	61271219	missense	probably damaging	1.00
R8797:Adamts14	UTSW	10	61271002	missense	probably benign	0.44
R8978:Adamts14	UTSW	10	61203016	missense	probably damaging	0.96
R9023:Adamts14	UTSW	10	61203001	missense	probably damaging	1.00
R9067:Adamts14	UTSW	10	61249660	missense	possibly damaging	0.78
R9326:Adamts14	UTSW	10	61200459	missense	probably benign	0.00
R9641:Adamts14	UTSW	10	61271050	missense	probably damaging	1.00
R9785:Adamts14	UTSW	10	61213648	missense	possibly damaging	0.83
Z1088:Adamts14	UTSW	10	61218445	missense	probably damaging	1.00
Z1177:Adamts14	UTSW	10	61198843	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GAGCCCTTCTGCGAAATGAC -3'
(R):5'- TGTGAGAAGTCCTTGTGTTCCC -3'

Sequencing Primer
(F):5'- GACTCTTTTAGAAGAAGCCACCTG -3'
(R):5'- CCCGGCTATGTGCTGTGAGATAG -3'

Posted On

2019-06-26