Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Arhgap45'

561400

Institutional Source

Beutler Lab

Gene Symbol

Arhgap45

Ensembl Gene

ENSMUSG00000035697

Gene Name

Rho GTPase activating protein 45

Synonyms

6330406L22Rik, Hmha1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80016653-80031472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80025482 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 493 (T493I)

Ref Sequence

ENSEMBL: ENSMUSP00000101012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043311
AA Change: T366I

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: T366I

Domain	Start	End	E-Value	Type
low complexity region	142	153	N/A	INTRINSIC
FCH	157	244	4.14e-17	SMART
low complexity region	255	269	N/A	INTRINSIC
low complexity region	309	324	N/A	INTRINSIC
low complexity region	330	345	N/A	INTRINSIC
low complexity region	527	536	N/A	INTRINSIC
C1	582	628	3.15e-8	SMART
RhoGAP	653	852	2.73e-73	SMART
low complexity region	856	869	N/A	INTRINSIC
Blast:RhoGAP	876	999	1e-21	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099501
AA Change: T482I

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: T482I

Domain	Start	End	E-Value	Type
low complexity region	258	269	N/A	INTRINSIC
FCH	273	360	4.14e-17	SMART
low complexity region	371	385	N/A	INTRINSIC
low complexity region	425	440	N/A	INTRINSIC
low complexity region	446	461	N/A	INTRINSIC
low complexity region	643	652	N/A	INTRINSIC
C1	698	744	3.15e-8	SMART
RhoGAP	769	968	2.73e-73	SMART
low complexity region	972	985	N/A	INTRINSIC
Blast:RhoGAP	992	1115	1e-21	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105373
AA Change: T493I

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: T493I

Domain	Start	End	E-Value	Type
low complexity region	269	280	N/A	INTRINSIC
FCH	284	371	4.14e-17	SMART
low complexity region	382	396	N/A	INTRINSIC
low complexity region	436	451	N/A	INTRINSIC
low complexity region	457	472	N/A	INTRINSIC
low complexity region	654	663	N/A	INTRINSIC
C1	709	755	3.15e-8	SMART
RhoGAP	780	979	2.73e-73	SMART
low complexity region	983	996	N/A	INTRINSIC
Blast:RhoGAP	1003	1126	1e-21	BLAST

Meta Mutation Damage Score

0.0745

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Arhgap45

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Arhgap45	APN	10	80028648	splice site	probably benign
IGL01414:Arhgap45	APN	10	80027104	missense	probably damaging	1.00
IGL01505:Arhgap45	APN	10	80026542	missense	probably benign	0.10
IGL02203:Arhgap45	APN	10	80027553	nonsense	probably null
IGL02557:Arhgap45	APN	10	80021638	missense	probably damaging	1.00
IGL02858:Arhgap45	APN	10	80017934	missense	probably benign	0.20
IGL03292:Arhgap45	APN	10	80020969	missense	probably benign	0.04
IGL03352:Arhgap45	APN	10	80030751	missense	probably damaging	0.96
Celt	UTSW	10	80020818	missense	probably damaging	1.00
celtic	UTSW	10	80027589	nonsense	probably null
druid	UTSW	10	80026347	critical splice donor site	probably null
Mistletoe	UTSW	10	80027102	nonsense	probably null
Roman	UTSW	10	80027597	missense	probably damaging	1.00
stonehenge	UTSW	10	80025482	missense	possibly damaging	0.81
IGL03048:Arhgap45	UTSW	10	80017017	missense	probably damaging	0.99
PIT4677001:Arhgap45	UTSW	10	80020749	missense	probably benign
R0532:Arhgap45	UTSW	10	80022083	missense	possibly damaging	0.92
R1233:Arhgap45	UTSW	10	80027582	missense	probably damaging	1.00
R1579:Arhgap45	UTSW	10	80028977	missense	probably damaging	1.00
R1666:Arhgap45	UTSW	10	80028750	missense	possibly damaging	0.82
R1668:Arhgap45	UTSW	10	80028750	missense	possibly damaging	0.82
R1688:Arhgap45	UTSW	10	80029095	missense	probably damaging	1.00
R1710:Arhgap45	UTSW	10	80018098	nonsense	probably null
R1902:Arhgap45	UTSW	10	80025466	missense	probably damaging	0.99
R1912:Arhgap45	UTSW	10	80020690	missense	probably benign	0.08
R1935:Arhgap45	UTSW	10	80030954	missense	probably damaging	1.00
R1936:Arhgap45	UTSW	10	80030954	missense	probably damaging	1.00
R1955:Arhgap45	UTSW	10	80026492	missense	probably benign	0.15
R1968:Arhgap45	UTSW	10	80027702	missense	probably damaging	1.00
R1977:Arhgap45	UTSW	10	80020818	missense	probably damaging	1.00
R1986:Arhgap45	UTSW	10	80020696	missense	probably damaging	1.00
R2074:Arhgap45	UTSW	10	80027180	missense	probably damaging	1.00
R2081:Arhgap45	UTSW	10	80027674	missense	probably damaging	1.00
R2162:Arhgap45	UTSW	10	80016979	start codon destroyed	probably null	0.02
R2937:Arhgap45	UTSW	10	80029002	missense	probably damaging	1.00
R2938:Arhgap45	UTSW	10	80029002	missense	probably damaging	1.00
R3081:Arhgap45	UTSW	10	80026447	missense	probably damaging	1.00
R4695:Arhgap45	UTSW	10	80025530	missense	probably damaging	1.00
R4736:Arhgap45	UTSW	10	80026172	missense	probably damaging	1.00
R4758:Arhgap45	UTSW	10	80030293	missense	probably benign	0.00
R4860:Arhgap45	UTSW	10	80027066	missense	probably damaging	1.00
R4860:Arhgap45	UTSW	10	80027066	missense	probably damaging	1.00
R4934:Arhgap45	UTSW	10	80020957	missense	probably damaging	1.00
R4943:Arhgap45	UTSW	10	80026503	missense	probably benign	0.00
R5102:Arhgap45	UTSW	10	80021428	missense	probably benign	0.01
R5128:Arhgap45	UTSW	10	80030959	missense	probably benign	0.16
R5667:Arhgap45	UTSW	10	80025476	missense	probably damaging	1.00
R5671:Arhgap45	UTSW	10	80025476	missense	probably damaging	1.00
R5920:Arhgap45	UTSW	10	80029131	missense	possibly damaging	0.87
R5998:Arhgap45	UTSW	10	80030950	missense	probably damaging	0.99
R6276:Arhgap45	UTSW	10	80026234	missense	probably benign	0.25
R6675:Arhgap45	UTSW	10	80018104	missense	probably null	0.98
R6738:Arhgap45	UTSW	10	80027597	missense	probably damaging	1.00
R6783:Arhgap45	UTSW	10	80017864	missense	possibly damaging	0.92
R6863:Arhgap45	UTSW	10	80017782	missense	probably benign	0.03
R6978:Arhgap45	UTSW	10	80021848	missense	probably benign	0.00
R7089:Arhgap45	UTSW	10	80026347	critical splice donor site	probably null
R7307:Arhgap45	UTSW	10	80029182	missense	probably benign	0.14
R7308:Arhgap45	UTSW	10	80026558	critical splice donor site	probably null
R7480:Arhgap45	UTSW	10	80027102	nonsense	probably null
R7481:Arhgap45	UTSW	10	80022300	missense	possibly damaging	0.80
R7649:Arhgap45	UTSW	10	80031001	missense	probably benign	0.00
R7652:Arhgap45	UTSW	10	80028838	missense	probably benign	0.01
R7748:Arhgap45	UTSW	10	80016932	unclassified	probably benign
R7883:Arhgap45	UTSW	10	80027589	nonsense	probably null
R8121:Arhgap45	UTSW	10	80018075	missense	probably damaging	0.99
R8169:Arhgap45	UTSW	10	80027872	missense	probably damaging	1.00
R8170:Arhgap45	UTSW	10	80027872	missense	probably damaging	1.00
R8175:Arhgap45	UTSW	10	80027872	missense	probably damaging	1.00
R8178:Arhgap45	UTSW	10	80027872	missense	probably damaging	1.00
R8186:Arhgap45	UTSW	10	80027872	missense	probably damaging	1.00
R8187:Arhgap45	UTSW	10	80027872	missense	probably damaging	1.00
R8687:Arhgap45	UTSW	10	80016787	unclassified	probably benign
R8866:Arhgap45	UTSW	10	80017916	missense	probably damaging	1.00
R8905:Arhgap45	UTSW	10	80019736	missense	probably benign	0.00
R9299:Arhgap45	UTSW	10	80026731	missense	possibly damaging	0.82
R9412:Arhgap45	UTSW	10	80019730	start codon destroyed	probably null	0.66
R9579:Arhgap45	UTSW	10	80018009	missense	probably benign
R9629:Arhgap45	UTSW	10	80027860	missense	probably damaging	1.00
R9710:Arhgap45	UTSW	10	80021801	missense	probably damaging	0.99
X0023:Arhgap45	UTSW	10	80030800	missense	probably damaging	0.98
X0063:Arhgap45	UTSW	10	80030356	missense	possibly damaging	0.51
Z1176:Arhgap45	UTSW	10	80025536	missense	probably damaging	1.00
Z1176:Arhgap45	UTSW	10	80029052	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCTTTCCACACTCATCATAAG -3'
(R):5'- TGCCACTAGAATCACCGTGC -3'

Sequencing Primer
(F):5'- GGGATTTTAGGCAAGAACTCCACTTC -3'
(R):5'- TAGAATCACCGTGCCAAACC -3'

Posted On

2019-06-26