Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Tspoap1'

561404

Institutional Source

Beutler Lab

Gene Symbol

Tspoap1

Ensembl Gene

ENSMUSG00000034156

Gene Name

TSPO associated protein 1

Synonyms

Bzrap1, peripheral

MMRRC Submission

045287-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87760541-87785928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87770489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 589 (I589N)

Ref Sequence

ENSEMBL: ENSMUSP00000048063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039627] [ENSMUST00000100644]

AlphaFold

Q7TNF8

Predicted Effect

probably benign
Transcript: ENSMUST00000039627
AA Change: I589N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000048063
Gene: ENSMUSG00000034156
AA Change: I589N

Domain	Start	End	E-Value	Type
coiled coil region	121	190	N/A	INTRINSIC
coiled coil region	219	249	N/A	INTRINSIC
low complexity region	301	309	N/A	INTRINSIC
coiled coil region	331	519	N/A	INTRINSIC
low complexity region	598	612	N/A	INTRINSIC
low complexity region	625	638	N/A	INTRINSIC
SH3	652	715	1.85e-11	SMART
low complexity region	733	759	N/A	INTRINSIC
FN3	784	864	3.14e0	SMART
FN3	878	951	4.81e-4	SMART
FN3	975	1062	7.16e0	SMART
low complexity region	1254	1265	N/A	INTRINSIC
low complexity region	1301	1313	N/A	INTRINSIC
low complexity region	1387	1401	N/A	INTRINSIC
low complexity region	1455	1471	N/A	INTRINSIC
SH3	1619	1683	5.4e-13	SMART
low complexity region	1721	1732	N/A	INTRINSIC
SH3	1758	1821	5.48e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100644
AA Change: I529N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000098209
Gene: ENSMUSG00000034156
AA Change: I529N

Domain	Start	End	E-Value	Type
coiled coil region	121	190	N/A	INTRINSIC
low complexity region	241	249	N/A	INTRINSIC
coiled coil region	271	459	N/A	INTRINSIC
low complexity region	538	552	N/A	INTRINSIC
low complexity region	565	578	N/A	INTRINSIC
SH3	592	655	1.85e-11	SMART
low complexity region	673	699	N/A	INTRINSIC
FN3	724	804	3.14e0	SMART
FN3	818	891	4.81e-4	SMART
FN3	915	1002	7.16e0	SMART
low complexity region	1194	1205	N/A	INTRINSIC
low complexity region	1241	1253	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1395	1411	N/A	INTRINSIC
SH3	1559	1623	5.4e-13	SMART
low complexity region	1661	1672	N/A	INTRINSIC
SH3	1698	1761	5.48e-14	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

PHENOTYPE: Homozygous double-KO with Rimbp2^tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Tspoap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Tspoap1	APN	11	87777821	splice site	probably null
IGL01718:Tspoap1	APN	11	87780255	missense	possibly damaging	0.90
IGL02427:Tspoap1	APN	11	87762515	missense	probably benign	0.00
IGL02487:Tspoap1	APN	11	87762516	missense	possibly damaging	0.90
IGL02730:Tspoap1	APN	11	87781709	missense	probably damaging	0.98
IGL02979:Tspoap1	APN	11	87770521	missense	probably damaging	1.00
R0384:Tspoap1	UTSW	11	87766454	missense	probably damaging	1.00
R0396:Tspoap1	UTSW	11	87776346	splice site	probably benign
R0470:Tspoap1	UTSW	11	87776162	missense	probably damaging	0.99
R0637:Tspoap1	UTSW	11	87777240	splice site	probably benign
R0671:Tspoap1	UTSW	11	87762809	missense	probably damaging	1.00
R0960:Tspoap1	UTSW	11	87770595	splice site	probably benign
R0989:Tspoap1	UTSW	11	87765823	missense	probably damaging	0.99
R1396:Tspoap1	UTSW	11	87766120	missense	probably damaging	1.00
R1792:Tspoap1	UTSW	11	87765881	splice site	probably null
R2901:Tspoap1	UTSW	11	87777975	missense	probably benign	0.00
R2902:Tspoap1	UTSW	11	87777975	missense	probably benign	0.00
R3969:Tspoap1	UTSW	11	87762446	missense	probably damaging	1.00
R4400:Tspoap1	UTSW	11	87775603	missense	probably damaging	1.00
R4599:Tspoap1	UTSW	11	87779521	missense	probably damaging	1.00
R4635:Tspoap1	UTSW	11	87777857	missense	probably benign	0.25
R4731:Tspoap1	UTSW	11	87765647	missense	probably benign	0.09
R4755:Tspoap1	UTSW	11	87771663	missense	possibly damaging	0.77
R4780:Tspoap1	UTSW	11	87778443	missense	possibly damaging	0.48
R4960:Tspoap1	UTSW	11	87766396	nonsense	probably null
R5494:Tspoap1	UTSW	11	87775205	missense	possibly damaging	0.47
R5687:Tspoap1	UTSW	11	87777126	missense	probably damaging	1.00
R6200:Tspoap1	UTSW	11	87761703	missense	possibly damaging	0.85
R6563:Tspoap1	UTSW	11	87777159	missense	possibly damaging	0.87
R6816:Tspoap1	UTSW	11	87765665	missense	probably benign
R6897:Tspoap1	UTSW	11	87765812	missense	probably damaging	1.00
R7141:Tspoap1	UTSW	11	87774697	missense	probably damaging	1.00
R7341:Tspoap1	UTSW	11	87766379	missense	probably damaging	1.00
R7360:Tspoap1	UTSW	11	87778521	missense	probably benign	0.09
R7394:Tspoap1	UTSW	11	87766119	nonsense	probably null
R7483:Tspoap1	UTSW	11	87761525	missense	probably benign	0.00
R7617:Tspoap1	UTSW	11	87763625	missense	probably benign	0.02
R7793:Tspoap1	UTSW	11	87764310	missense	probably benign	0.00
R7814:Tspoap1	UTSW	11	87775524	missense	probably damaging	1.00
R8371:Tspoap1	UTSW	11	87778301	missense	probably benign	0.01
R8768:Tspoap1	UTSW	11	87778371	missense	probably benign	0.03
R8987:Tspoap1	UTSW	11	87763568	missense	probably damaging	1.00
R9004:Tspoap1	UTSW	11	87779458	missense
R9259:Tspoap1	UTSW	11	87779524	missense
R9339:Tspoap1	UTSW	11	87778013	missense	probably benign	0.01
R9424:Tspoap1	UTSW	11	87761256	start gained	probably benign
R9439:Tspoap1	UTSW	11	87774709	missense	probably damaging	0.98
R9455:Tspoap1	UTSW	11	87770533	missense	probably damaging	1.00
Z1176:Tspoap1	UTSW	11	87776057	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- ATCACAGTGAGTTTCTCCTCAACG -3'
(R):5'- TTTCTTCCACAAGTCAGGACCC -3'

Sequencing Primer
(F):5'- ATCTGGGTATAAAGGCCAGATACC -3'
(R):5'- AAGTCAGGACCCACCCC -3'

Posted On

2019-06-26