Incidental Mutation 'R7215:Ezh1'
ID 561405
Institutional Source Beutler Lab
Gene Symbol Ezh1
Ensembl Gene ENSMUSG00000006920
Gene Name enhancer of zeste 1 polycomb repressive complex 2 subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7215 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 101191115-101226463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101215299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 87 (T87S)
Ref Sequence ENSEMBL: ENSMUSP00000102906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100417] [ENSMUST00000107284] [ENSMUST00000107285]
AlphaFold P70351
Predicted Effect possibly damaging
Transcript: ENSMUST00000100417
AA Change: T84S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097984
Gene: ENSMUSG00000006920
AA Change: T84S

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 1.8e-20 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
PDB:4MI0|A 521 558 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107284
AA Change: T84S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920
AA Change: T84S

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107285
AA Change: T87S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920
AA Change: T87S

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: This gene encodes a member of the Polycomb-group (PcG) family. The encoded protein is interchangeable with the related Enhancer of zeste 2 (Ezh2) protein as a core component of the polycomb repressive complex 2 (PRC2), which methylates histone H3 at lysine 27 and results in the transcriptional repression of affected target genes. This complex is involved in carrying out cell-fate decisions during embryonic stem cell differentiation. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and healthy. Mice homozygous for a conditional allele activated in hematopoietic stem cells exhibit bone marrow failure with defective HSC maintenance and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Ezh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ezh1 APN 11 101194506 splice site probably null
IGL00481:Ezh1 APN 11 101199302 missense possibly damaging 0.68
IGL01327:Ezh1 APN 11 101203436 missense probably damaging 0.97
IGL01475:Ezh1 APN 11 101192961 missense probably damaging 1.00
IGL01693:Ezh1 APN 11 101215258 missense probably benign
IGL01896:Ezh1 APN 11 101213755 missense probably benign 0.00
IGL02022:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02024:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02028:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02053:Ezh1 APN 11 101199943 splice site probably benign
IGL02101:Ezh1 APN 11 101195566 missense possibly damaging 0.50
IGL02445:Ezh1 APN 11 101210687 missense possibly damaging 0.49
IGL02882:Ezh1 APN 11 101203289 missense probably benign 0.02
IGL03303:Ezh1 APN 11 101195671 splice site probably null
IGL03493:Ezh1 APN 11 101203791 missense probably benign 0.02
R1099:Ezh1 UTSW 11 101193808 critical splice acceptor site probably null
R1119:Ezh1 UTSW 11 101210535 splice site probably benign
R1434:Ezh1 UTSW 11 101194917 missense probably damaging 1.00
R1477:Ezh1 UTSW 11 101192984 missense probably damaging 0.98
R2114:Ezh1 UTSW 11 101208185 missense probably benign 0.04
R3105:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R3106:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R4272:Ezh1 UTSW 11 101194908 missense probably damaging 1.00
R4820:Ezh1 UTSW 11 101203768 missense probably damaging 1.00
R5016:Ezh1 UTSW 11 101199237 intron probably benign
R5237:Ezh1 UTSW 11 101216993 critical splice donor site probably null
R6392:Ezh1 UTSW 11 101203804 missense probably damaging 0.96
R6892:Ezh1 UTSW 11 101199361 nonsense probably null
R7488:Ezh1 UTSW 11 101200900 missense possibly damaging 0.51
R7604:Ezh1 UTSW 11 101217029 missense probably benign
R7819:Ezh1 UTSW 11 101194914 missense probably damaging 0.98
R8696:Ezh1 UTSW 11 101209479 missense probably benign
R9168:Ezh1 UTSW 11 101195607 missense probably damaging 1.00
R9382:Ezh1 UTSW 11 101203439 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTTTGCGGTATGCCCTGAC -3'
(R):5'- CTGGAAGGAAACTAAAGAGTGTTTC -3'

Sequencing Primer
(F):5'- GCCCTGACAGTCTTTACTCTAAAAG -3'
(R):5'- TCAGACACTGCAGTTGC -3'
Posted On 2019-06-26