Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Ttll5'

561409

Institutional Source

Beutler Lab

Gene Symbol

Ttll5

Ensembl Gene

ENSMUSG00000012609

Gene Name

tubulin tyrosine ligase-like family, member 5

Synonyms

STAMP

MMRRC Submission

Accession Numbers

Genbank: NM_001081423

Essential gene?

Possibly essential (E-score: 0.555) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85824659-86061893 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85933396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 918 (V918E)

Ref Sequence

ENSEMBL: ENSMUSP00000048809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]

AlphaFold

Q8CHB8

Predicted Effect

probably benign
Transcript: ENSMUST00000040179
AA Change: V918E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: V918E

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1.9e-94	PFAM
low complexity region	556	575	N/A	INTRINSIC
low complexity region	595	621	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	835	847	N/A	INTRINSIC
low complexity region	1167	1181	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000040273
AA Change: V918E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: V918E

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1e-94	PFAM
low complexity region	556	575	N/A	INTRINSIC
low complexity region	595	621	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	835	847	N/A	INTRINSIC
low complexity region	1167	1181	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110224
AA Change: V905E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: V905E

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1e-94	PFAM
low complexity region	543	562	N/A	INTRINSIC
low complexity region	582	608	N/A	INTRINSIC
low complexity region	734	748	N/A	INTRINSIC
low complexity region	768	780	N/A	INTRINSIC
low complexity region	822	834	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155448

SMART Domains

Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	6.4e-95	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176460

Predicted Effect

probably benign
Transcript: ENSMUST00000176695

SMART Domains

Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.1e-95	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176937

Predicted Effect

probably benign
Transcript: ENSMUST00000177114

SMART Domains

Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.1e-95	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000134874
Gene: ENSMUSG00000012609
AA Change: V353E

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
low complexity region	183	197	N/A	INTRINSIC
low complexity region	217	229	N/A	INTRINSIC
low complexity region	271	283	N/A	INTRINSIC
low complexity region	603	617	N/A	INTRINSIC

Predicted Effect

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Col22a1	A	T	15: 71,970,332	C434*	probably null	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Ttll5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Ttll5	APN	12	85843826	missense	probably damaging	1.00
IGL00932:Ttll5	APN	12	85929907	missense	probably damaging	1.00
IGL00964:Ttll5	APN	12	85849283	missense	possibly damaging	0.78
IGL00978:Ttll5	APN	12	85933482	nonsense	probably null
IGL00990:Ttll5	APN	12	85876589	missense	probably damaging	1.00
IGL01726:Ttll5	APN	12	85918934	missense	probably benign	0.30
IGL01797:Ttll5	APN	12	85956597	missense	possibly damaging	0.54
IGL02008:Ttll5	APN	12	85933611	missense	probably damaging	1.00
IGL02210:Ttll5	APN	12	85912545	intron	probably benign
IGL02979:Ttll5	APN	12	85826582	missense	probably damaging	1.00
IGL03079:Ttll5	APN	12	85876558	missense	probably damaging	1.00
IGL03149:Ttll5	APN	12	85918984	missense	probably damaging	0.98
G4846:Ttll5	UTSW	12	86024244	missense	probably damaging	0.99
PIT4812001:Ttll5	UTSW	12	85926861	missense	probably benign	0.12
R0045:Ttll5	UTSW	12	85879359	splice site	probably benign
R0153:Ttll5	UTSW	12	85831966	missense	probably damaging	1.00
R0282:Ttll5	UTSW	12	85996053	missense	probably benign	0.12
R0318:Ttll5	UTSW	12	85876594	critical splice donor site	probably null
R0465:Ttll5	UTSW	12	85933326	missense	probably benign	0.42
R0540:Ttll5	UTSW	12	85933676	critical splice donor site	probably null
R1086:Ttll5	UTSW	12	85891079	missense	possibly damaging	0.66
R1467:Ttll5	UTSW	12	85918962	splice site	probably null
R1470:Ttll5	UTSW	12	85879394	missense	possibly damaging	0.59
R1470:Ttll5	UTSW	12	85879394	missense	possibly damaging	0.59
R1505:Ttll5	UTSW	12	85879410	missense	probably damaging	1.00
R1524:Ttll5	UTSW	12	85864568	nonsense	probably null
R1540:Ttll5	UTSW	12	85892208	nonsense	probably null
R1598:Ttll5	UTSW	12	85863598	missense	probably damaging	0.98
R1649:Ttll5	UTSW	12	85923014	missense	probably damaging	1.00
R1774:Ttll5	UTSW	12	85933402	missense	probably benign	0.09
R2340:Ttll5	UTSW	12	85892148	missense	probably benign	0.02
R4049:Ttll5	UTSW	12	86012799	missense	probably benign	0.01
R4094:Ttll5	UTSW	12	85956602	nonsense	probably null
R4095:Ttll5	UTSW	12	85956602	nonsense	probably null
R4908:Ttll5	UTSW	12	85919174	missense	probably benign	0.31
R5012:Ttll5	UTSW	12	85926844	missense	possibly damaging	0.93
R5137:Ttll5	UTSW	12	85923045	missense	possibly damaging	0.83
R5416:Ttll5	UTSW	12	86012828	missense	possibly damaging	0.77
R5773:Ttll5	UTSW	12	85933555	frame shift	probably null
R5774:Ttll5	UTSW	12	85933555	frame shift	probably null
R6039:Ttll5	UTSW	12	85831955	missense	probably damaging	1.00
R6039:Ttll5	UTSW	12	85831955	missense	probably damaging	1.00
R6173:Ttll5	UTSW	12	85933377	missense	probably damaging	0.99
R6343:Ttll5	UTSW	12	85956699	missense	probably benign	0.00
R6449:Ttll5	UTSW	12	86024276	missense	probably benign	0.00
R6750:Ttll5	UTSW	12	85956610	missense	probably damaging	0.98
R6802:Ttll5	UTSW	12	85879386	missense	probably damaging	1.00
R6825:Ttll5	UTSW	12	85883328	splice site	probably null
R6955:Ttll5	UTSW	12	85864579	missense	possibly damaging	0.91
R7098:Ttll5	UTSW	12	85917673	critical splice acceptor site	probably null
R7154:Ttll5	UTSW	12	85925764	missense	probably damaging	0.98
R7339:Ttll5	UTSW	12	85857464	critical splice donor site	probably null
R7520:Ttll5	UTSW	12	85899471	missense	probably damaging	1.00
R7728:Ttll5	UTSW	12	85956632	missense	probably benign	0.02
R7894:Ttll5	UTSW	12	85889174	missense	probably damaging	1.00
R8119:Ttll5	UTSW	12	86020548	missense	probably damaging	0.98
R8129:Ttll5	UTSW	12	85891084	critical splice donor site	probably null
R8200:Ttll5	UTSW	12	85879410	missense	probably damaging	1.00
R8357:Ttll5	UTSW	12	85876578	missense	probably damaging	1.00
R8413:Ttll5	UTSW	12	85919121	missense	probably benign	0.00
R8457:Ttll5	UTSW	12	85876578	missense	probably damaging	1.00
R9086:Ttll5	UTSW	12	85917742	missense	possibly damaging	0.94
R9086:Ttll5	UTSW	12	86024333	missense	probably benign
R9265:Ttll5	UTSW	12	85891021	nonsense	probably null
R9293:Ttll5	UTSW	12	85891032	missense	probably damaging	1.00
R9302:Ttll5	UTSW	12	85826564	missense	possibly damaging	0.63
R9621:Ttll5	UTSW	12	85892122	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GTTCACGTGTCATAGAGATTGTATG -3'
(R):5'- TGCGGCACTTTGGAAAGAG -3'

Sequencing Primer
(F):5'- GGCGAAACTAGTGTATACC -3'
(R):5'- CAATGGTGTAGCTGCCGGATC -3'

Posted On

2019-06-26