Incidental Mutation 'R7215:Ttll5'
ID561409
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
MMRRC Submission
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R7215 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85933396 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 918 (V918E)
Ref Sequence ENSEMBL: ENSMUSP00000048809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably benign
Transcript: ENSMUST00000040179
AA Change: V918E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: V918E

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040273
AA Change: V918E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: V918E

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110224
AA Change: V905E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: V905E

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155448
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176460
Predicted Effect probably benign
Transcript: ENSMUST00000176695
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176937
Predicted Effect probably benign
Transcript: ENSMUST00000177114
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000134874
Gene: ENSMUSG00000012609
AA Change: V353E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
PIT4812001:Ttll5 UTSW 12 85926861 missense probably benign 0.12
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6825:Ttll5 UTSW 12 85883328 intron probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site probably null
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACGTGTCATAGAGATTGTATG -3'
(R):5'- TGCGGCACTTTGGAAAGAG -3'

Sequencing Primer
(F):5'- GGCGAAACTAGTGTATACC -3'
(R):5'- CAATGGTGTAGCTGCCGGATC -3'
Posted On2019-06-26