Mutagenetix > Incidental Mutation

Incidental Mutation 'R7215:Col22a1'

561419

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

MMRRC Submission

045287-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 71970332 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 434 (C434*)

Ref Sequence

ENSEMBL: ENSMUSP00000125069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993]

AlphaFold

E9Q7P1

Predicted Effect

probably null
Transcript: ENSMUST00000159993
AA Change: C434*

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: C434*

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	G	A	13: 77,323,571	V1032M	possibly damaging	Het
Abca13	T	A	11: 9,288,405		probably null	Het
Adamts14	T	A	10: 61,211,596	H739L	possibly damaging	Het
Adgrl3	A	G	5: 81,693,550	E758G	probably damaging	Het
Ano3	T	A	2: 110,665,932	T826S	probably damaging	Het
Arhgap45	C	T	10: 80,025,482	T493I	possibly damaging	Het
Atg9b	A	C	5: 24,388,041	W455G	probably damaging	Het
Atp4a	A	G	7: 30,717,360	N496S	possibly damaging	Het
Bckdk	T	A	7: 127,905,110	D60E	possibly damaging	Het
Blmh	A	T	11: 76,965,899	K244*	probably null	Het
Btbd17	T	C	11: 114,791,465	I474V	possibly damaging	Het
C87436	A	G	6: 86,462,680	E451G	possibly damaging	Het
Camta1	T	C	4: 151,144,737	E546G	probably damaging	Het
Casp1	A	G	9: 5,298,523		probably null	Het
Ccdc114	C	T	7: 45,936,622	R148C	probably damaging	Het
Ccdc116	A	G	16: 17,139,928	Y456H	probably damaging	Het
Cep350	A	C	1: 155,894,707	S1812R	possibly damaging	Het
Chrna10	A	G	7: 102,112,208	L392P	possibly damaging	Het
Cxcl9	G	A	5: 92,323,888	Q98*	probably null	Het
Cyp2c54	G	A	19: 40,046,182	T348I	probably damaging	Het
Dnah7a	G	A	1: 53,618,350	R756C	probably damaging	Het
Dnajc18	T	C	18: 35,681,981	T239A	probably benign	Het
Dnase2a	A	T	8: 84,909,770		probably null	Het
Dpyd	A	G	3: 119,266,032	T793A	probably benign	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Edil3	T	C	13: 88,822,050		probably null	Het
Ehd1	T	A	19: 6,297,642	I342N	possibly damaging	Het
Erbb4	A	T	1: 68,339,460	S341T	probably benign	Het
Ezh1	T	A	11: 101,215,299	T87S	probably benign	Het
Fam20b	A	T	1: 156,690,553	W224R	probably damaging	Het
Galns	A	T	8: 122,599,348		probably null	Het
Gm13283	C	T	4: 88,760,730		probably benign	Het
Gm15448	C	T	7: 3,822,311	C444Y	unknown	Het
Gm49342	A	T	14: 50,944,583	M23L	probably benign	Het
Gm5114	T	A	7: 39,411,371	H18L	probably benign	Het
Gpr89	A	G	3: 96,880,088	W299R	probably damaging	Het
Hadha	G	T	5: 30,119,842	N755K	probably benign	Het
Inpp5d	A	T	1: 87,701,218	H620L	probably benign	Het
Klk1b3	T	A	7: 44,200,404		probably null	Het
Macf1	T	C	4: 123,507,304	T663A	probably damaging	Het
Man1b1	A	G	2: 25,350,390	N601S	probably benign	Het
Mbtps1	A	G	8: 119,524,568	V605A	possibly damaging	Het
Med23	C	G	10: 24,888,429	D311E	probably benign	Het
Myo3a	G	T	2: 22,245,567	D82Y	possibly damaging	Het
Nsd1	T	A	13: 55,247,641	D1121E	probably benign	Het
Olfr1042	C	T	2: 86,159,456	V305I	probably benign	Het
Olfr1221	G	A	2: 89,112,501	Q4*	probably null	Het
Olfr918	A	G	9: 38,673,447	I12T	probably benign	Het
Otoa	T	C	7: 121,118,572	V19A	unknown	Het
Pcdhb20	A	T	18: 37,505,386	T322S	probably benign	Het
Pecam1	T	C	11: 106,695,919	T257A	probably benign	Het
Pi16	G	T	17: 29,319,098		probably benign	Het
Pik3c2g	C	T	6: 139,754,863	T293M		Het
Pkhd1l1	T	A	15: 44,528,163	C1542S	possibly damaging	Het
Prrc2b	G	A	2: 32,229,297	G2172R	probably damaging	Het
Prrt1	A	T	17: 34,629,703		probably null	Het
Ptprb	T	A	10: 116,338,776	N784K	possibly damaging	Het
Rem1	C	A	2: 152,628,149	S18R	probably damaging	Het
Ripk4	G	A	16: 97,747,323		probably null	Het
Scn8a	G	A	15: 101,029,830	V1397I	possibly damaging	Het
Setbp1	T	A	18: 78,856,837	H1205L	probably damaging	Het
Shmt1	T	C	11: 60,801,535	I132V	probably damaging	Het
Slc24a1	T	A	9: 64,928,503	T781S	unknown	Het
Sncaip	C	T	18: 52,907,343	Q870*	probably null	Het
Stab1	A	T	14: 31,160,797	N416K	possibly damaging	Het
Tcea1	A	G	1: 4,867,483	D26G	probably damaging	Het
Tcf20	A	T	15: 82,853,489	S1254T	probably benign	Het
Tead4	T	A	6: 128,228,678	I354F	probably damaging	Het
Tex36	G	A	7: 133,587,418	R142*	probably null	Het
Trav6d-3	T	A	14: 52,725,342	L12Q	probably damaging	Het
Trpc4	A	G	3: 54,194,896	T72A	possibly damaging	Het
Trrap	G	A	5: 144,797,135	A933T	probably benign	Het
Tspoap1	T	A	11: 87,770,489	I589N	probably benign	Het
Ttll5	T	A	12: 85,933,396	V918E	probably benign	Het
Txn2	A	G	15: 77,927,686		probably null	Het
Ucn3	T	G	13: 3,941,365	T96P	probably benign	Het
Usp36	T	C	11: 118,265,154	E764G	possibly damaging	Het
Vmn2r23	A	T	6: 123,704,364	H77L	probably benign	Het
Vmn2r57	T	C	7: 41,400,286	T680A	probably benign	Het
Vwa3a	T	C	7: 120,795,630	I891T	possibly damaging	Het
Zcchc11	T	C	4: 108,527,008	Y1091H	probably damaging	Het
Zhx2	A	G	15: 57,823,643	I803V	probably benign	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
R8769:Col22a1	UTSW	15	72006722	missense	probably benign	0.21
R8780:Col22a1	UTSW	15	72006947	missense	probably damaging	0.99
R8827:Col22a1	UTSW	15	71902816	critical splice donor site	probably null
R8843:Col22a1	UTSW	15	72006654	missense	probably damaging	1.00
R8982:Col22a1	UTSW	15	71973638	critical splice donor site	probably null
R9031:Col22a1	UTSW	15	71881674	nonsense	probably null
R9036:Col22a1	UTSW	15	71890582	missense	probably damaging	1.00
R9084:Col22a1	UTSW	15	71820080	missense	unknown
R9281:Col22a1	UTSW	15	71861071	missense	unknown
R9386:Col22a1	UTSW	15	71981945	missense	probably damaging	1.00
R9406:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R9577:Col22a1	UTSW	15	71965746	missense	probably damaging	0.99
R9727:Col22a1	UTSW	15	71977274	missense	probably damaging	1.00
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACTGTTGCCCTGTTTAACTTGG -3'
(R):5'- GCATGGCAATTGGGTACACAG -3'

Sequencing Primer
(F):5'- GCTCATGCTGCATAAATGGTTAG -3'
(R):5'- TTGGGTACACAGACCATGC -3'

Posted On

2019-06-26