Incidental Mutation 'R7215:Dnajc18'
ID561424
Institutional Source Beutler Lab
Gene Symbol Dnajc18
Ensembl Gene ENSMUSG00000024350
Gene NameDnaJ heat shock protein family (Hsp40) member C18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7215 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location35671103-35703144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35681981 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 239 (T239A)
Ref Sequence ENSEMBL: ENSMUSP00000025208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025208]
Predicted Effect probably benign
Transcript: ENSMUST00000025208
AA Change: T239A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025208
Gene: ENSMUSG00000024350
AA Change: T239A

DomainStartEndE-ValueType
DnaJ 81 138 6.52e-27 SMART
low complexity region 200 218 N/A INTRINSIC
Pfam:DUF1977 243 349 1.7e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Dnajc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Dnajc18 APN 18 35680942 splice site probably benign
IGL01152:Dnajc18 APN 18 35680873 missense probably benign 0.02
IGL01621:Dnajc18 APN 18 35680840 missense probably benign
IGL03201:Dnajc18 APN 18 35680919 missense probably benign 0.19
R1464:Dnajc18 UTSW 18 35680847 missense possibly damaging 0.88
R1464:Dnajc18 UTSW 18 35680847 missense possibly damaging 0.88
R1801:Dnajc18 UTSW 18 35680804 missense probably damaging 1.00
R3893:Dnajc18 UTSW 18 35700995 splice site probably null
R4974:Dnajc18 UTSW 18 35683319 missense possibly damaging 0.75
R5234:Dnajc18 UTSW 18 35683298 missense probably benign 0.12
R6326:Dnajc18 UTSW 18 35680925 missense possibly damaging 0.95
R6360:Dnajc18 UTSW 18 35686709 missense probably damaging 1.00
R6460:Dnajc18 UTSW 18 35700910 missense probably benign 0.41
R7492:Dnajc18 UTSW 18 35686793 missense probably damaging 1.00
X0063:Dnajc18 UTSW 18 35686733 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAGCATTATGTTTCCACAGGAAG -3'
(R):5'- TTGACAGTGCAGGTTGGAAG -3'

Sequencing Primer
(F):5'- CATTATGTTTCCACAGGAAGGTGAG -3'
(R):5'- CCTTTGGGATGTCTTCATCC -3'
Posted On2019-06-26