Incidental Mutation 'R7216:Sec62'
ID561439
Institutional Source Beutler Lab
Gene Symbol Sec62
Ensembl Gene ENSMUSG00000027706
Gene NameSEC62 homolog (S. cerevisiae)
Synonyms3100002M17Rik, Dtrp1, Tloc1, HTP1, SEC62
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R7216 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location30792875-30821263 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 30818829 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 354 (Q354*)
Ref Sequence ENSEMBL: ENSMUSP00000029256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029256]
Predicted Effect probably null
Transcript: ENSMUST00000029256
AA Change: Q354*
SMART Domains Protein: ENSMUSP00000029256
Gene: ENSMUSG00000027706
AA Change: Q354*

DomainStartEndE-ValueType
Pfam:Sec62 87 311 1.1e-78 PFAM
low complexity region 338 357 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC63 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,140,457 N1551K probably benign Het
Amy2a1 T C 3: 113,530,441 D150G possibly damaging Het
Atp2b1 T A 10: 98,986,977 C165S probably benign Het
Atp2c1 A T 9: 105,467,731 D102E probably benign Het
Capn8 C A 1: 182,598,798 R233S possibly damaging Het
Cd48 T C 1: 171,695,822 S78P probably damaging Het
Clasp1 T A 1: 118,547,918 D944E probably benign Het
Clip2 A G 5: 134,502,917 M678T probably benign Het
Clmp T C 9: 40,760,909 Y12H possibly damaging Het
Col22a1 A T 15: 71,973,845 V356D probably damaging Het
Copg2 A T 6: 30,885,600 D101E probably damaging Het
Cpsf6 G A 10: 117,362,023 P229S unknown Het
Dgke T C 11: 89,050,337 D340G probably benign Het
Dlg1 TAAA TAA 16: 31,796,918 probably null Het
Dlg5 G A 14: 24,136,638 Q1865* probably null Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Egln2 T C 7: 27,159,829 D365G probably damaging Het
Epha4 T C 1: 77,444,984 D287G probably damaging Het
Fat4 A G 3: 38,891,043 T1362A probably damaging Het
Flt4 A G 11: 49,634,681 T685A possibly damaging Het
Fras1 T C 5: 96,739,314 Y2652H probably damaging Het
Gas2 A G 7: 51,897,257 E52G possibly damaging Het
Gm11639 A T 11: 104,880,549 K2633N possibly damaging Het
Gm13103 A G 4: 143,851,829 I220V probably damaging Het
Gm5093 A T 17: 46,440,088 D4E not run Het
Gm6370 A T 5: 146,493,913 T303S probably benign Het
Gpr161 A G 1: 165,306,546 I126V probably benign Het
Gpr63 T C 4: 25,008,038 L254P probably damaging Het
H2-M9 C T 17: 36,640,702 V294I probably benign Het
Insr T A 8: 3,203,034 N375I possibly damaging Het
Ints1 T C 5: 139,768,984 N600S possibly damaging Het
Ints10 A G 8: 68,822,157 N628S probably damaging Het
Irf2 A G 8: 46,793,556 T20A probably benign Het
Irs1 T A 1: 82,289,755 T247S probably damaging Het
Islr C T 9: 58,156,967 S419N unknown Het
Kcna2 T A 3: 107,104,793 I230N probably damaging Het
Kif3c C A 12: 3,366,126 A49E probably benign Het
Kifap3 A T 1: 163,795,989 K108N probably damaging Het
Lama3 T A 18: 12,430,000 F527I probably damaging Het
Layn A G 9: 51,077,052 probably benign Het
Lims2 G T 18: 31,957,262 W276L probably damaging Het
Lsp1 T C 7: 142,488,442 L133S probably damaging Het
Map3k6 T G 4: 133,246,900 V536G probably damaging Het
Med7 T A 11: 46,440,854 L92H probably damaging Het
Mllt1 A G 17: 56,927,042 V48A probably damaging Het
Mpp5 G A 12: 78,797,232 R70H probably damaging Het
Neurl4 T A 11: 69,910,262 V1153E probably damaging Het
Nkx2-1 A C 12: 56,534,802 C87G probably damaging Het
Nsun7 T C 5: 66,278,657 S291P probably damaging Het
Olfr148 A T 9: 39,614,494 Q309L probably benign Het
Olfr1508 G A 14: 52,463,488 P174S probably damaging Het
Olfr406 A T 11: 74,269,724 I112F probably damaging Het
Olfr46 A T 7: 140,610,460 N90I possibly damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Pbrm1 A G 14: 31,045,422 Y331C possibly damaging Het
Pirb T A 7: 3,716,274 T539S probably benign Het
Plch2 T G 4: 154,984,228 T1314P probably benign Het
Polk T C 13: 96,508,220 S133G probably benign Het
Prdm5 A T 6: 65,927,983 K533* probably null Het
Prmt1 T A 7: 44,983,573 Q35H probably benign Het
Pum3 A T 19: 27,424,225 W142R probably damaging Het
Rest G A 5: 77,282,608 R958H probably benign Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Ripor2 G A 13: 24,671,903 G109R probably damaging Het
Snx14 T C 9: 88,381,791 Y847C probably damaging Het
Soga1 T C 2: 157,018,370 R1650G possibly damaging Het
Sox7 A T 14: 63,947,989 D158V probably benign Het
Spag8 A G 4: 43,652,034 V350A possibly damaging Het
Syngr1 A T 15: 80,111,733 I158F probably damaging Het
Tacstd2 C A 6: 67,534,995 V238L probably benign Het
Tex15 T C 8: 33,572,986 S815P possibly damaging Het
Tmem117 A T 15: 94,714,912 T110S possibly damaging Het
Tnrc6a T C 7: 123,171,495 I836T probably benign Het
Trim30b C A 7: 104,357,362 V96L probably benign Het
Tssk3 TGCTATCATGGGG TG 4: 129,489,313 probably null Het
Tyk2 G T 9: 21,120,526 H418N probably benign Het
Uap1 G T 1: 170,158,903 T170K probably damaging Het
Vmn1r40 T C 6: 89,714,624 V141A not run Het
Vmn1r54 T A 6: 90,269,665 I187K probably damaging Het
Vmp1 C T 11: 86,602,033 V317M probably damaging Het
Wnt8b A G 19: 44,512,072 K366R probably benign Het
Zfp207 C T 11: 80,395,178 P415L unknown Het
Zfp263 A G 16: 3,744,571 E66G probably damaging Het
Zfp985 T A 4: 147,583,456 H260Q probably damaging Het
Zmiz1 GCC GC 14: 25,576,200 probably null Het
Zmiz1 A C 14: 25,576,207 Q46P probably damaging Het
Zmiz1 A G 14: 25,576,209 R47G probably damaging Het
Other mutations in Sec62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sec62 APN 3 30810442 splice site probably benign
IGL01359:Sec62 APN 3 30814306 missense unknown
IGL01746:Sec62 APN 3 30814246 missense probably benign 0.39
IGL02437:Sec62 APN 3 30818847 missense unknown
IGL03355:Sec62 APN 3 30809922 missense unknown
R2400:Sec62 UTSW 3 30810532 missense unknown
R4423:Sec62 UTSW 3 30814282 missense unknown
R4649:Sec62 UTSW 3 30810534 missense unknown
R4717:Sec62 UTSW 3 30809871 missense unknown
R4837:Sec62 UTSW 3 30809869 missense unknown
R5775:Sec62 UTSW 3 30793287 utr 5 prime probably benign
R6153:Sec62 UTSW 3 30810482 missense unknown
R6275:Sec62 UTSW 3 30809836 missense probably damaging 0.98
R6734:Sec62 UTSW 3 30810460 missense probably benign 0.39
R7250:Sec62 UTSW 3 30812347 missense possibly damaging 0.57
R7453:Sec62 UTSW 3 30809796 intron probably null
Predicted Primers PCR Primer
(F):5'- GGCTTCATTGACTCCTTCAGG -3'
(R):5'- CATGATGATCGGCCAACACAG -3'

Sequencing Primer
(F):5'- TTCAGGCCCCTGTACACACATG -3'
(R):5'- TGATGATCGGCCAACACAGAAAAC -3'
Posted On2019-06-26