Incidental Mutation 'R7216:Nsun7'
ID561451
Institutional Source Beutler Lab
Gene Symbol Nsun7
Ensembl Gene ENSMUSG00000029206
Gene NameNOL1/NOP2/Sun domain family, member 7
Synonyms4921525L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7216 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location66259897-66298026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66278657 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 291 (S291P)
Ref Sequence ENSEMBL: ENSMUSP00000144498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031109] [ENSMUST00000201100] [ENSMUST00000202994]
Predicted Effect probably damaging
Transcript: ENSMUST00000031109
AA Change: S291P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031109
Gene: ENSMUSG00000029206
AA Change: S291P

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 394 477 4.2e-7 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201100
AA Change: S291P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144520
Gene: ENSMUSG00000029206
AA Change: S291P

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 312 479 4.3e-9 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202994
AA Change: S291P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144498
Gene: ENSMUSG00000029206
AA Change: S291P

DomainStartEndE-ValueType
PDB:2B9E|A 205 479 5e-17 PDB
low complexity region 509 521 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOL1/NOP2/sun domain RNA methyltransferase family. Mice with a mutation in this gene exhibit male sterility due to impaired sperm motility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Males homozygous for an ENU-induced mutation are either infertile or subfertile. Mutant sperm exhibit poor progressive motility linked to rigidity of the flagellar midpiece and abnormal electron density patterns in the mitochondrial sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,140,457 N1551K probably benign Het
Amy2a1 T C 3: 113,530,441 D150G possibly damaging Het
Atp2b1 T A 10: 98,986,977 C165S probably benign Het
Atp2c1 A T 9: 105,467,731 D102E probably benign Het
Capn8 C A 1: 182,598,798 R233S possibly damaging Het
Cd48 T C 1: 171,695,822 S78P probably damaging Het
Clasp1 T A 1: 118,547,918 D944E probably benign Het
Clip2 A G 5: 134,502,917 M678T probably benign Het
Clmp T C 9: 40,760,909 Y12H possibly damaging Het
Col22a1 A T 15: 71,973,845 V356D probably damaging Het
Copg2 A T 6: 30,885,600 D101E probably damaging Het
Cpsf6 G A 10: 117,362,023 P229S unknown Het
Dgke T C 11: 89,050,337 D340G probably benign Het
Dlg1 TAAA TAA 16: 31,796,918 probably null Het
Dlg5 G A 14: 24,136,638 Q1865* probably null Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Egln2 T C 7: 27,159,829 D365G probably damaging Het
Epha4 T C 1: 77,444,984 D287G probably damaging Het
Fat4 A G 3: 38,891,043 T1362A probably damaging Het
Flt4 A G 11: 49,634,681 T685A possibly damaging Het
Fras1 T C 5: 96,739,314 Y2652H probably damaging Het
Gas2 A G 7: 51,897,257 E52G possibly damaging Het
Gm11639 A T 11: 104,880,549 K2633N possibly damaging Het
Gm13103 A G 4: 143,851,829 I220V probably damaging Het
Gm5093 A T 17: 46,440,088 D4E not run Het
Gm6370 A T 5: 146,493,913 T303S probably benign Het
Gpr161 A G 1: 165,306,546 I126V probably benign Het
Gpr63 T C 4: 25,008,038 L254P probably damaging Het
H2-M9 C T 17: 36,640,702 V294I probably benign Het
Insr T A 8: 3,203,034 N375I possibly damaging Het
Ints1 T C 5: 139,768,984 N600S possibly damaging Het
Ints10 A G 8: 68,822,157 N628S probably damaging Het
Irf2 A G 8: 46,793,556 T20A probably benign Het
Irs1 T A 1: 82,289,755 T247S probably damaging Het
Islr C T 9: 58,156,967 S419N unknown Het
Kcna2 T A 3: 107,104,793 I230N probably damaging Het
Kif3c C A 12: 3,366,126 A49E probably benign Het
Kifap3 A T 1: 163,795,989 K108N probably damaging Het
Lama3 T A 18: 12,430,000 F527I probably damaging Het
Layn A G 9: 51,077,052 probably benign Het
Lims2 G T 18: 31,957,262 W276L probably damaging Het
Lsp1 T C 7: 142,488,442 L133S probably damaging Het
Map3k6 T G 4: 133,246,900 V536G probably damaging Het
Med7 T A 11: 46,440,854 L92H probably damaging Het
Mllt1 A G 17: 56,927,042 V48A probably damaging Het
Mpp5 G A 12: 78,797,232 R70H probably damaging Het
Neurl4 T A 11: 69,910,262 V1153E probably damaging Het
Nkx2-1 A C 12: 56,534,802 C87G probably damaging Het
Olfr148 A T 9: 39,614,494 Q309L probably benign Het
Olfr1508 G A 14: 52,463,488 P174S probably damaging Het
Olfr406 A T 11: 74,269,724 I112F probably damaging Het
Olfr46 A T 7: 140,610,460 N90I possibly damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Pbrm1 A G 14: 31,045,422 Y331C possibly damaging Het
Pirb T A 7: 3,716,274 T539S probably benign Het
Plch2 T G 4: 154,984,228 T1314P probably benign Het
Polk T C 13: 96,508,220 S133G probably benign Het
Prdm5 A T 6: 65,927,983 K533* probably null Het
Prmt1 T A 7: 44,983,573 Q35H probably benign Het
Pum3 A T 19: 27,424,225 W142R probably damaging Het
Rest G A 5: 77,282,608 R958H probably benign Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Ripor2 G A 13: 24,671,903 G109R probably damaging Het
Sec62 C T 3: 30,818,829 Q354* probably null Het
Snx14 T C 9: 88,381,791 Y847C probably damaging Het
Soga1 T C 2: 157,018,370 R1650G possibly damaging Het
Sox7 A T 14: 63,947,989 D158V probably benign Het
Spag8 A G 4: 43,652,034 V350A possibly damaging Het
Syngr1 A T 15: 80,111,733 I158F probably damaging Het
Tacstd2 C A 6: 67,534,995 V238L probably benign Het
Tex15 T C 8: 33,572,986 S815P possibly damaging Het
Tmem117 A T 15: 94,714,912 T110S possibly damaging Het
Tnrc6a T C 7: 123,171,495 I836T probably benign Het
Trim30b C A 7: 104,357,362 V96L probably benign Het
Tssk3 TGCTATCATGGGG TG 4: 129,489,313 probably null Het
Tyk2 G T 9: 21,120,526 H418N probably benign Het
Uap1 G T 1: 170,158,903 T170K probably damaging Het
Vmn1r40 T C 6: 89,714,624 V141A not run Het
Vmn1r54 T A 6: 90,269,665 I187K probably damaging Het
Vmp1 C T 11: 86,602,033 V317M probably damaging Het
Wnt8b A G 19: 44,512,072 K366R probably benign Het
Zfp207 C T 11: 80,395,178 P415L unknown Het
Zfp263 A G 16: 3,744,571 E66G probably damaging Het
Zfp985 T A 4: 147,583,456 H260Q probably damaging Het
Zmiz1 GCC GC 14: 25,576,200 probably null Het
Zmiz1 A C 14: 25,576,207 Q46P probably damaging Het
Zmiz1 A G 14: 25,576,209 R47G probably damaging Het
Other mutations in Nsun7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Nsun7 APN 5 66289503 missense probably benign 0.00
IGL01013:Nsun7 APN 5 66283601 missense possibly damaging 0.87
IGL01355:Nsun7 APN 5 66294868 missense probably damaging 1.00
IGL01768:Nsun7 APN 5 66278700 missense probably benign 0.11
IGL01914:Nsun7 APN 5 66276634 missense probably damaging 1.00
IGL01990:Nsun7 APN 5 66261073 missense probably damaging 1.00
IGL02477:Nsun7 APN 5 66276649 missense probably damaging 0.99
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0079:Nsun7 UTSW 5 66295513 missense probably benign 0.00
R0255:Nsun7 UTSW 5 66289408 splice site probably benign
R0503:Nsun7 UTSW 5 66283581 splice site probably benign
R0540:Nsun7 UTSW 5 66283634 missense probably damaging 0.98
R1416:Nsun7 UTSW 5 66261080 missense probably damaging 0.98
R1471:Nsun7 UTSW 5 66284229 missense probably benign 0.00
R1942:Nsun7 UTSW 5 66284245 missense probably benign 0.00
R1981:Nsun7 UTSW 5 66261214 missense probably damaging 0.99
R2037:Nsun7 UTSW 5 66261086 missense probably benign 0.06
R2098:Nsun7 UTSW 5 66283712 missense probably damaging 0.98
R2226:Nsun7 UTSW 5 66261219 nonsense probably null
R2996:Nsun7 UTSW 5 66295554 missense probably benign 0.01
R3882:Nsun7 UTSW 5 66278640 missense probably damaging 0.99
R4678:Nsun7 UTSW 5 66261064 missense probably benign 0.00
R4681:Nsun7 UTSW 5 66261199 missense probably benign 0.00
R4997:Nsun7 UTSW 5 66295839 missense probably benign 0.02
R6108:Nsun7 UTSW 5 66295799 missense probably damaging 0.99
R6465:Nsun7 UTSW 5 66295586 missense probably benign 0.35
R6500:Nsun7 UTSW 5 66295484 missense probably benign 0.11
R6746:Nsun7 UTSW 5 66283737 critical splice donor site probably null
R6925:Nsun7 UTSW 5 66277072 missense probably damaging 1.00
R7032:Nsun7 UTSW 5 66264035 missense probably benign 0.02
R7084:Nsun7 UTSW 5 66295421 missense probably damaging 1.00
R7098:Nsun7 UTSW 5 66260983 missense probably damaging 0.98
R7276:Nsun7 UTSW 5 66277141 missense probably benign 0.03
R7803:Nsun7 UTSW 5 66276541 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTAAACCGTAGACATAATCGGGG -3'
(R):5'- GGCGCATACTTTGACATCCC -3'

Sequencing Primer
(F):5'- TTGTTGCCTTCCAGGTAGAC -3'
(R):5'- CATTCTTGTAAAAAGTTTCCTCGC -3'
Posted On2019-06-26