Incidental Mutation 'R7216:Prdm5'
ID561458
Institutional Source Beutler Lab
Gene Symbol Prdm5
Ensembl Gene ENSMUSG00000029913
Gene NamePR domain containing 5
SynonymsPFM2, 4432417F03Rik, 6530401I24Rik, E130112L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7216 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location65778988-65937010 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 65927983 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 533 (K533*)
Ref Sequence ENSEMBL: ENSMUSP00000031976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031973] [ENSMUST00000031976] [ENSMUST00000081219] [ENSMUST00000172638]
Predicted Effect probably null
Transcript: ENSMUST00000031973
AA Change: K349*
SMART Domains Protein: ENSMUSP00000031973
Gene: ENSMUSG00000029913
AA Change: K349*

DomainStartEndE-ValueType
PDB:3EP0|B 4 101 1e-11 PDB
Blast:SET 8 100 4e-64 BLAST
ZnF_C2H2 105 127 3.16e-3 SMART
ZnF_C2H2 133 155 8.81e-2 SMART
ZnF_C2H2 161 183 1.95e-3 SMART
ZnF_C2H2 189 211 6.78e-3 SMART
ZnF_C2H2 217 240 1.2e-3 SMART
ZnF_C2H2 246 268 4.87e-4 SMART
ZnF_C2H2 274 296 2.4e-3 SMART
ZnF_C2H2 302 324 2.43e-4 SMART
ZnF_C2H2 330 352 3.21e-4 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 387 410 1.43e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000031976
AA Change: K533*
SMART Domains Protein: ENSMUSP00000031976
Gene: ENSMUSG00000029913
AA Change: K533*

DomainStartEndE-ValueType
SET 8 130 2.01e-4 SMART
ZnF_C2H2 167 190 3.39e-3 SMART
ZnF_C2H2 199 221 1.04e-3 SMART
ZnF_C2H2 231 256 1.26e-2 SMART
ZnF_C2H2 264 286 1.95e-3 SMART
ZnF_C2H2 289 311 3.16e-3 SMART
ZnF_C2H2 317 339 8.81e-2 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 6.78e-3 SMART
ZnF_C2H2 401 424 1.2e-3 SMART
ZnF_C2H2 430 452 4.87e-4 SMART
ZnF_C2H2 458 480 2.4e-3 SMART
ZnF_C2H2 486 508 2.43e-4 SMART
ZnF_C2H2 514 536 3.21e-4 SMART
ZnF_C2H2 542 564 1.45e-2 SMART
ZnF_C2H2 571 594 1.43e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081219
AA Change: K155*
SMART Domains Protein: ENSMUSP00000079979
Gene: ENSMUSG00000029913
AA Change: K155*

DomainStartEndE-ValueType
Blast:SET 8 72 2e-34 BLAST
ZnF_C2H2 80 102 2.4e-3 SMART
ZnF_C2H2 108 130 2.43e-4 SMART
ZnF_C2H2 136 158 3.21e-4 SMART
ZnF_C2H2 164 186 1.45e-2 SMART
ZnF_C2H2 193 216 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172638
SMART Domains Protein: ENSMUSP00000133423
Gene: ENSMUSG00000029913

DomainStartEndE-ValueType
SET 8 130 2.01e-4 SMART
ZnF_C2H2 167 190 3.39e-3 SMART
ZnF_C2H2 199 221 1.04e-3 SMART
ZnF_C2H2 231 256 1.26e-2 SMART
ZnF_C2H2 264 286 1.95e-3 SMART
ZnF_C2H2 289 311 3.16e-3 SMART
ZnF_C2H2 317 339 8.81e-2 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 6.78e-3 SMART
ZnF_C2H2 401 424 1.2e-3 SMART
ZnF_C2H2 430 452 4.87e-4 SMART
ZnF_C2H2 458 480 2.4e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor of the PR-domain protein family. It contains a PR-domain and multiple zinc finger motifs. Transcription factors of the PR-domain family are known to be involved in cell differentiation and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display delayed bone ossification with reduced collagen fibril formation, total bone area, bone mineral content and bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,140,457 N1551K probably benign Het
Amy2a1 T C 3: 113,530,441 D150G possibly damaging Het
Atp2b1 T A 10: 98,986,977 C165S probably benign Het
Atp2c1 A T 9: 105,467,731 D102E probably benign Het
Capn8 C A 1: 182,598,798 R233S possibly damaging Het
Cd48 T C 1: 171,695,822 S78P probably damaging Het
Clasp1 T A 1: 118,547,918 D944E probably benign Het
Clip2 A G 5: 134,502,917 M678T probably benign Het
Clmp T C 9: 40,760,909 Y12H possibly damaging Het
Col22a1 A T 15: 71,973,845 V356D probably damaging Het
Copg2 A T 6: 30,885,600 D101E probably damaging Het
Cpsf6 G A 10: 117,362,023 P229S unknown Het
Dgke T C 11: 89,050,337 D340G probably benign Het
Dlg1 TAAA TAA 16: 31,796,918 probably null Het
Dlg5 G A 14: 24,136,638 Q1865* probably null Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Egln2 T C 7: 27,159,829 D365G probably damaging Het
Epha4 T C 1: 77,444,984 D287G probably damaging Het
Fat4 A G 3: 38,891,043 T1362A probably damaging Het
Flt4 A G 11: 49,634,681 T685A possibly damaging Het
Fras1 T C 5: 96,739,314 Y2652H probably damaging Het
Gas2 A G 7: 51,897,257 E52G possibly damaging Het
Gm11639 A T 11: 104,880,549 K2633N possibly damaging Het
Gm13103 A G 4: 143,851,829 I220V probably damaging Het
Gm5093 A T 17: 46,440,088 D4E not run Het
Gm6370 A T 5: 146,493,913 T303S probably benign Het
Gpr161 A G 1: 165,306,546 I126V probably benign Het
Gpr63 T C 4: 25,008,038 L254P probably damaging Het
H2-M9 C T 17: 36,640,702 V294I probably benign Het
Insr T A 8: 3,203,034 N375I possibly damaging Het
Ints1 T C 5: 139,768,984 N600S possibly damaging Het
Ints10 A G 8: 68,822,157 N628S probably damaging Het
Irf2 A G 8: 46,793,556 T20A probably benign Het
Irs1 T A 1: 82,289,755 T247S probably damaging Het
Islr C T 9: 58,156,967 S419N unknown Het
Kcna2 T A 3: 107,104,793 I230N probably damaging Het
Kif3c C A 12: 3,366,126 A49E probably benign Het
Kifap3 A T 1: 163,795,989 K108N probably damaging Het
Lama3 T A 18: 12,430,000 F527I probably damaging Het
Layn A G 9: 51,077,052 probably benign Het
Lims2 G T 18: 31,957,262 W276L probably damaging Het
Lsp1 T C 7: 142,488,442 L133S probably damaging Het
Map3k6 T G 4: 133,246,900 V536G probably damaging Het
Med7 T A 11: 46,440,854 L92H probably damaging Het
Mllt1 A G 17: 56,927,042 V48A probably damaging Het
Mpp5 G A 12: 78,797,232 R70H probably damaging Het
Neurl4 T A 11: 69,910,262 V1153E probably damaging Het
Nkx2-1 A C 12: 56,534,802 C87G probably damaging Het
Nsun7 T C 5: 66,278,657 S291P probably damaging Het
Olfr148 A T 9: 39,614,494 Q309L probably benign Het
Olfr1508 G A 14: 52,463,488 P174S probably damaging Het
Olfr406 A T 11: 74,269,724 I112F probably damaging Het
Olfr46 A T 7: 140,610,460 N90I possibly damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Pbrm1 A G 14: 31,045,422 Y331C possibly damaging Het
Pirb T A 7: 3,716,274 T539S probably benign Het
Plch2 T G 4: 154,984,228 T1314P probably benign Het
Polk T C 13: 96,508,220 S133G probably benign Het
Prmt1 T A 7: 44,983,573 Q35H probably benign Het
Pum3 A T 19: 27,424,225 W142R probably damaging Het
Rest G A 5: 77,282,608 R958H probably benign Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Ripor2 G A 13: 24,671,903 G109R probably damaging Het
Sec62 C T 3: 30,818,829 Q354* probably null Het
Snx14 T C 9: 88,381,791 Y847C probably damaging Het
Soga1 T C 2: 157,018,370 R1650G possibly damaging Het
Sox7 A T 14: 63,947,989 D158V probably benign Het
Spag8 A G 4: 43,652,034 V350A possibly damaging Het
Syngr1 A T 15: 80,111,733 I158F probably damaging Het
Tacstd2 C A 6: 67,534,995 V238L probably benign Het
Tex15 T C 8: 33,572,986 S815P possibly damaging Het
Tmem117 A T 15: 94,714,912 T110S possibly damaging Het
Tnrc6a T C 7: 123,171,495 I836T probably benign Het
Trim30b C A 7: 104,357,362 V96L probably benign Het
Tssk3 TGCTATCATGGGG TG 4: 129,489,313 probably null Het
Tyk2 G T 9: 21,120,526 H418N probably benign Het
Uap1 G T 1: 170,158,903 T170K probably damaging Het
Vmn1r40 T C 6: 89,714,624 V141A not run Het
Vmn1r54 T A 6: 90,269,665 I187K probably damaging Het
Vmp1 C T 11: 86,602,033 V317M probably damaging Het
Wnt8b A G 19: 44,512,072 K366R probably benign Het
Zfp207 C T 11: 80,395,178 P415L unknown Het
Zfp263 A G 16: 3,744,571 E66G probably damaging Het
Zfp985 T A 4: 147,583,456 H260Q probably damaging Het
Zmiz1 GCC GC 14: 25,576,200 probably null Het
Zmiz1 A C 14: 25,576,207 Q46P probably damaging Het
Zmiz1 A G 14: 25,576,209 R47G probably damaging Het
Other mutations in Prdm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Prdm5 APN 6 65870390 missense possibly damaging 0.93
IGL02363:Prdm5 APN 6 65794319 missense probably damaging 1.00
IGL02457:Prdm5 APN 6 65881116 missense probably damaging 1.00
IGL03190:Prdm5 APN 6 65856132 splice site probably benign
IGL03239:Prdm5 APN 6 65886078 splice site probably benign
IGL03377:Prdm5 APN 6 65859473 missense possibly damaging 0.93
R0329:Prdm5 UTSW 6 65862903 splice site probably benign
R0926:Prdm5 UTSW 6 65883547 missense probably damaging 0.99
R1458:Prdm5 UTSW 6 65883601 missense probably damaging 0.99
R1859:Prdm5 UTSW 6 65831279 missense probably benign 0.03
R1956:Prdm5 UTSW 6 65936076 missense probably damaging 1.00
R1996:Prdm5 UTSW 6 65936088 missense probably damaging 1.00
R1997:Prdm5 UTSW 6 65936088 missense probably damaging 1.00
R2019:Prdm5 UTSW 6 65831356 missense probably damaging 0.99
R3082:Prdm5 UTSW 6 65936085 missense probably damaging 1.00
R3819:Prdm5 UTSW 6 65936057 missense possibly damaging 0.92
R4411:Prdm5 UTSW 6 65901787 nonsense probably null
R4981:Prdm5 UTSW 6 65870462 missense probably damaging 0.99
R5077:Prdm5 UTSW 6 65779174 missense probably damaging 0.97
R5089:Prdm5 UTSW 6 65856090 missense probably benign 0.01
R5138:Prdm5 UTSW 6 65856102 nonsense probably null
R5735:Prdm5 UTSW 6 65927990 missense possibly damaging 0.93
R6355:Prdm5 UTSW 6 65883594 missense probably damaging 1.00
R6743:Prdm5 UTSW 6 65883651 missense probably damaging 1.00
R6769:Prdm5 UTSW 6 65862936 missense probably damaging 0.98
R7305:Prdm5 UTSW 6 65831260 missense possibly damaging 0.83
R7510:Prdm5 UTSW 6 65927992 missense probably damaging 0.97
X0017:Prdm5 UTSW 6 65869262 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCAGCCACTCACTTTTCTGTG -3'
(R):5'- CTGCTAGAAAACCATGATGAGTAG -3'

Sequencing Primer
(F):5'- AATCAGCCATCTTTCCATGGAGG -3'
(R):5'- ACCATGATGAGTAGAATATGAATGC -3'
Posted On2019-06-26