Mutagenetix > Incidental Mutations

Incidental Mutation 'R7216:Ints10'

561474

Institutional Source

Beutler Lab

Gene Symbol

Ints10

Ensembl Gene

ENSMUSG00000031864

Gene Name

integrator complex subunit 10

Synonyms

4921521J11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7216 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68793929-68831667 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68822157 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 628 (N628S)

Ref Sequence

ENSEMBL: ENSMUSP00000069908 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034328] [ENSMUST00000070713] [ENSMUST00000110241] [ENSMUST00000110242]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034328
AA Change: N628S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000034328
Gene: ENSMUSG00000031864
AA Change: N628S

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000070713
AA Change: N628S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000069908
Gene: ENSMUSG00000031864
AA Change: N628S

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110241
AA Change: N628S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105870
Gene: ENSMUSG00000031864
AA Change: N628S

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110242
AA Change: N628S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105871
Gene: ENSMUSG00000031864
AA Change: N628S

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000118390
Gene: ENSMUSG00000031864
AA Change: N44S

Domain	Start	End	E-Value	Type
low complexity region	92	111	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap6	T	A	12: 53,140,457	N1551K	probably benign	Het
Amy2a1	T	C	3: 113,530,441	D150G	possibly damaging	Het
Atp2b1	T	A	10: 98,986,977	C165S	probably benign	Het
Atp2c1	A	T	9: 105,467,731	D102E	probably benign	Het
Capn8	C	A	1: 182,598,798	R233S	possibly damaging	Het
Cd48	T	C	1: 171,695,822	S78P	probably damaging	Het
Clasp1	T	A	1: 118,547,918	D944E	probably benign	Het
Clip2	A	G	5: 134,502,917	M678T	probably benign	Het
Clmp	T	C	9: 40,760,909	Y12H	possibly damaging	Het
Col22a1	A	T	15: 71,973,845	V356D	probably damaging	Het
Copg2	A	T	6: 30,885,600	D101E	probably damaging	Het
Cpsf6	G	A	10: 117,362,023	P229S	unknown	Het
Dgke	T	C	11: 89,050,337	D340G	probably benign	Het
Dlg1	TAAA	TAA	16: 31,796,918		probably null	Het
Dlg5	G	A	14: 24,136,638	Q1865*	probably null	Het
Dnajc2	C	T	5: 21,776,779	R123Q	probably damaging	Het
E430018J23Rik	A	G	7: 127,391,523	S431P	probably benign	Het
Egln2	T	C	7: 27,159,829	D365G	probably damaging	Het
Epha4	T	C	1: 77,444,984	D287G	probably damaging	Het
Fat4	A	G	3: 38,891,043	T1362A	probably damaging	Het
Flt4	A	G	11: 49,634,681	T685A	possibly damaging	Het
Fras1	T	C	5: 96,739,314	Y2652H	probably damaging	Het
Gas2	A	G	7: 51,897,257	E52G	possibly damaging	Het
Gm11639	A	T	11: 104,880,549	K2633N	possibly damaging	Het
Gm13103	A	G	4: 143,851,829	I220V	probably damaging	Het
Gm5093	A	T	17: 46,440,088	D4E	not run	Het
Gm6370	A	T	5: 146,493,913	T303S	probably benign	Het
Gpr161	A	G	1: 165,306,546	I126V	probably benign	Het
Gpr63	T	C	4: 25,008,038	L254P	probably damaging	Het
H2-M9	C	T	17: 36,640,702	V294I	probably benign	Het
Insr	T	A	8: 3,203,034	N375I	possibly damaging	Het
Ints1	T	C	5: 139,768,984	N600S	possibly damaging	Het
Irf2	A	G	8: 46,793,556	T20A	probably benign	Het
Irs1	T	A	1: 82,289,755	T247S	probably damaging	Het
Islr	C	T	9: 58,156,967	S419N	unknown	Het
Kcna2	T	A	3: 107,104,793	I230N	probably damaging	Het
Kif3c	C	A	12: 3,366,126	A49E	probably benign	Het
Kifap3	A	T	1: 163,795,989	K108N	probably damaging	Het
Lama3	T	A	18: 12,430,000	F527I	probably damaging	Het
Layn	A	G	9: 51,077,052		probably benign	Het
Lims2	G	T	18: 31,957,262	W276L	probably damaging	Het
Lsp1	T	C	7: 142,488,442	L133S	probably damaging	Het
Map3k6	T	G	4: 133,246,900	V536G	probably damaging	Het
Med7	T	A	11: 46,440,854	L92H	probably damaging	Het
Mllt1	A	G	17: 56,927,042	V48A	probably damaging	Het
Mpp5	G	A	12: 78,797,232	R70H	probably damaging	Het
Neurl4	T	A	11: 69,910,262	V1153E	probably damaging	Het
Nkx2-1	A	C	12: 56,534,802	C87G	probably damaging	Het
Nsun7	T	C	5: 66,278,657	S291P	probably damaging	Het
Olfr148	A	T	9: 39,614,494	Q309L	probably benign	Het
Olfr1508	G	A	14: 52,463,488	P174S	probably damaging	Het
Olfr406	A	T	11: 74,269,724	I112F	probably damaging	Het
Olfr46	A	T	7: 140,610,460	N90I	possibly damaging	Het
Olfr829	T	A	9: 18,857,336	M237K	probably benign	Het
Pbrm1	A	G	14: 31,045,422	Y331C	possibly damaging	Het
Pirb	T	A	7: 3,716,274	T539S	probably benign	Het
Plch2	T	G	4: 154,984,228	T1314P	probably benign	Het
Polk	T	C	13: 96,508,220	S133G	probably benign	Het
Prdm5	A	T	6: 65,927,983	K533*	probably null	Het
Prmt1	T	A	7: 44,983,573	Q35H	probably benign	Het
Pum3	A	T	19: 27,424,225	W142R	probably damaging	Het
Rest	G	A	5: 77,282,608	R958H	probably benign	Het
Rictor	C	T	15: 6,769,301	T343M	probably damaging	Het
Ripor2	G	A	13: 24,671,903	G109R	probably damaging	Het
Sec62	C	T	3: 30,818,829	Q354*	probably null	Het
Snx14	T	C	9: 88,381,791	Y847C	probably damaging	Het
Soga1	T	C	2: 157,018,370	R1650G	possibly damaging	Het
Sox7	A	T	14: 63,947,989	D158V	probably benign	Het
Spag8	A	G	4: 43,652,034	V350A	possibly damaging	Het
Syngr1	A	T	15: 80,111,733	I158F	probably damaging	Het
Tacstd2	C	A	6: 67,534,995	V238L	probably benign	Het
Tex15	T	C	8: 33,572,986	S815P	possibly damaging	Het
Tmem117	A	T	15: 94,714,912	T110S	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,495	I836T	probably benign	Het
Trim30b	C	A	7: 104,357,362	V96L	probably benign	Het
Tssk3	TGCTATCATGGGG	TG	4: 129,489,313		probably null	Het
Tyk2	G	T	9: 21,120,526	H418N	probably benign	Het
Uap1	G	T	1: 170,158,903	T170K	probably damaging	Het
Vmn1r40	T	C	6: 89,714,624	V141A	not run	Het
Vmn1r54	T	A	6: 90,269,665	I187K	probably damaging	Het
Vmp1	C	T	11: 86,602,033	V317M	probably damaging	Het
Wnt8b	A	G	19: 44,512,072	K366R	probably benign	Het
Zfp207	C	T	11: 80,395,178	P415L	unknown	Het
Zfp263	A	G	16: 3,744,571	E66G	probably damaging	Het
Zfp985	T	A	4: 147,583,456	H260Q	probably damaging	Het
Zmiz1	A	C	14: 25,576,207	Q46P	probably damaging	Het
Zmiz1	A	G	14: 25,576,209	R47G	probably damaging	Het
Zmiz1	GCC	GC	14: 25,576,200		probably null	Het

Other mutations in Ints10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Ints10	APN	8	68819333	missense	probably damaging	1.00
IGL00964:Ints10	APN	8	68811986	missense	probably damaging	1.00
IGL02326:Ints10	APN	8	68804833	missense	probably damaging	0.99
R0012:Ints10	UTSW	8	68807475	missense	probably benign	0.01
R0112:Ints10	UTSW	8	68827302	missense	probably damaging	0.99
R1302:Ints10	UTSW	8	68827312	missense	probably damaging	1.00
R1462:Ints10	UTSW	8	68807644	splice site	probably benign
R1540:Ints10	UTSW	8	68796713	splice site	probably benign
R1592:Ints10	UTSW	8	68802903	missense	possibly damaging	0.69
R1845:Ints10	UTSW	8	68794671	missense	probably damaging	1.00
R2144:Ints10	UTSW	8	68796805	missense	probably damaging	1.00
R2323:Ints10	UTSW	8	68819345	missense	probably benign	0.09
R3765:Ints10	UTSW	8	68825119	missense	possibly damaging	0.78
R3910:Ints10	UTSW	8	68813620	missense	probably damaging	0.96
R3912:Ints10	UTSW	8	68813620	missense	probably damaging	0.96
R3913:Ints10	UTSW	8	68813620	missense	probably damaging	0.96
R4050:Ints10	UTSW	8	68827351	missense	probably damaging	1.00
R4151:Ints10	UTSW	8	68794598	splice site	probably null
R4607:Ints10	UTSW	8	68810619	missense	probably damaging	1.00
R4608:Ints10	UTSW	8	68810619	missense	probably damaging	1.00
R4881:Ints10	UTSW	8	68810604	missense	probably benign	0.08
R4911:Ints10	UTSW	8	68827312	missense	probably damaging	0.98
R5255:Ints10	UTSW	8	68793972	start gained	probably benign
R5331:Ints10	UTSW	8	68820820	splice site	probably null
R5461:Ints10	UTSW	8	68794041	missense	possibly damaging	0.59
R5740:Ints10	UTSW	8	68804922	missense	probably damaging	0.96
R5741:Ints10	UTSW	8	68804922	missense	probably damaging	0.96
R6128:Ints10	UTSW	8	68822252	critical splice donor site	probably null
R6465:Ints10	UTSW	8	68807536	missense	probably benign
R6868:Ints10	UTSW	8	68797798	missense	probably damaging	1.00
R6983:Ints10	UTSW	8	68794051	missense	probably damaging	1.00
R7076:Ints10	UTSW	8	68796751	nonsense	probably null
R7652:Ints10	UTSW	8	68825119	missense	possibly damaging	0.78
R8134:Ints10	UTSW	8	68802986	nonsense	probably null
R8176:Ints10	UTSW	8	68802951	missense	probably damaging	1.00
R8185:Ints10	UTSW	8	68796718	missense	possibly damaging	0.51
X0027:Ints10	UTSW	8	68808474	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AACGAGCTTCTTTCCATAGGG -3'
(R):5'- GACCCTTGAAAACTGAGACCAG -3'

Sequencing Primer
(F):5'- GCAGTTTGGTTAACGTAAAAGTCAGC -3'
(R):5'- TGAGACCAGTTTGGAATCCTTTC -3'

Posted On

2019-06-26