Incidental Mutation 'R7216:Mpp5'
ID561496
Institutional Source Beutler Lab
Gene Symbol Mpp5
Ensembl Gene ENSMUSG00000021112
Gene Namemembrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
SynonymsPals1, 3830420B02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R7216 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location78748907-78840714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78797232 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 70 (R70H)
Ref Sequence ENSEMBL: ENSMUSP00000080683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082024] [ENSMUST00000219197] [ENSMUST00000219667]
PDB Structure Solution structure of the PDZ domain of Pals1 protein [SOLUTION NMR]
2.1 Angstrom crystal structure of the PALS-1-L27N and PATJ L27 heterodimer complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000082024
AA Change: R70H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080683
Gene: ENSMUSG00000021112
AA Change: R70H

DomainStartEndE-ValueType
coiled coil region 54 76 N/A INTRINSIC
L27 123 180 2.04e-10 SMART
L27 186 238 7.39e-8 SMART
PDZ 265 336 5.99e-13 SMART
SH3 348 416 1.2e-10 SMART
low complexity region 439 454 N/A INTRINSIC
GuKc 478 663 1.72e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000219197
AA Change: R70H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219667
AA Change: R36H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the p55-like subfamily of the membrane-associated guanylate kinase (MAGUK) gene superfamily. The encoded protein participates in the polarization of differentiating cells, has been shown to regulate myelinating Schwann cells (PMID: 20237282), and is one of the components of the Crumbs complex in the retina. Mice which express lower levels of the orthologous protein have retinal degeneration and impaired vision (PMID: 22114289). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a floxed allele activated in cortical neuron exhibit loss of cortex neurons due to premature differentiation and increased apoptosis. These mice also exhibit behavioral defects but are otherwise viable and fertile. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,140,457 N1551K probably benign Het
Amy2a1 T C 3: 113,530,441 D150G possibly damaging Het
Atp2b1 T A 10: 98,986,977 C165S probably benign Het
Atp2c1 A T 9: 105,467,731 D102E probably benign Het
Capn8 C A 1: 182,598,798 R233S possibly damaging Het
Cd48 T C 1: 171,695,822 S78P probably damaging Het
Clasp1 T A 1: 118,547,918 D944E probably benign Het
Clip2 A G 5: 134,502,917 M678T probably benign Het
Clmp T C 9: 40,760,909 Y12H possibly damaging Het
Col22a1 A T 15: 71,973,845 V356D probably damaging Het
Copg2 A T 6: 30,885,600 D101E probably damaging Het
Cpsf6 G A 10: 117,362,023 P229S unknown Het
Dgke T C 11: 89,050,337 D340G probably benign Het
Dlg1 TAAA TAA 16: 31,796,918 probably null Het
Dlg5 G A 14: 24,136,638 Q1865* probably null Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Egln2 T C 7: 27,159,829 D365G probably damaging Het
Epha4 T C 1: 77,444,984 D287G probably damaging Het
Fat4 A G 3: 38,891,043 T1362A probably damaging Het
Flt4 A G 11: 49,634,681 T685A possibly damaging Het
Fras1 T C 5: 96,739,314 Y2652H probably damaging Het
Gas2 A G 7: 51,897,257 E52G possibly damaging Het
Gm11639 A T 11: 104,880,549 K2633N possibly damaging Het
Gm13103 A G 4: 143,851,829 I220V probably damaging Het
Gm5093 A T 17: 46,440,088 D4E not run Het
Gm6370 A T 5: 146,493,913 T303S probably benign Het
Gpr161 A G 1: 165,306,546 I126V probably benign Het
Gpr63 T C 4: 25,008,038 L254P probably damaging Het
H2-M9 C T 17: 36,640,702 V294I probably benign Het
Insr T A 8: 3,203,034 N375I possibly damaging Het
Ints1 T C 5: 139,768,984 N600S possibly damaging Het
Ints10 A G 8: 68,822,157 N628S probably damaging Het
Irf2 A G 8: 46,793,556 T20A probably benign Het
Irs1 T A 1: 82,289,755 T247S probably damaging Het
Islr C T 9: 58,156,967 S419N unknown Het
Kcna2 T A 3: 107,104,793 I230N probably damaging Het
Kif3c C A 12: 3,366,126 A49E probably benign Het
Kifap3 A T 1: 163,795,989 K108N probably damaging Het
Lama3 T A 18: 12,430,000 F527I probably damaging Het
Layn A G 9: 51,077,052 probably benign Het
Lims2 G T 18: 31,957,262 W276L probably damaging Het
Lsp1 T C 7: 142,488,442 L133S probably damaging Het
Map3k6 T G 4: 133,246,900 V536G probably damaging Het
Med7 T A 11: 46,440,854 L92H probably damaging Het
Mllt1 A G 17: 56,927,042 V48A probably damaging Het
Neurl4 T A 11: 69,910,262 V1153E probably damaging Het
Nkx2-1 A C 12: 56,534,802 C87G probably damaging Het
Nsun7 T C 5: 66,278,657 S291P probably damaging Het
Olfr148 A T 9: 39,614,494 Q309L probably benign Het
Olfr1508 G A 14: 52,463,488 P174S probably damaging Het
Olfr406 A T 11: 74,269,724 I112F probably damaging Het
Olfr46 A T 7: 140,610,460 N90I possibly damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Pbrm1 A G 14: 31,045,422 Y331C possibly damaging Het
Pirb T A 7: 3,716,274 T539S probably benign Het
Plch2 T G 4: 154,984,228 T1314P probably benign Het
Polk T C 13: 96,508,220 S133G probably benign Het
Prdm5 A T 6: 65,927,983 K533* probably null Het
Prmt1 T A 7: 44,983,573 Q35H probably benign Het
Pum3 A T 19: 27,424,225 W142R probably damaging Het
Rest G A 5: 77,282,608 R958H probably benign Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Ripor2 G A 13: 24,671,903 G109R probably damaging Het
Sec62 C T 3: 30,818,829 Q354* probably null Het
Snx14 T C 9: 88,381,791 Y847C probably damaging Het
Soga1 T C 2: 157,018,370 R1650G possibly damaging Het
Sox7 A T 14: 63,947,989 D158V probably benign Het
Spag8 A G 4: 43,652,034 V350A possibly damaging Het
Syngr1 A T 15: 80,111,733 I158F probably damaging Het
Tacstd2 C A 6: 67,534,995 V238L probably benign Het
Tex15 T C 8: 33,572,986 S815P possibly damaging Het
Tmem117 A T 15: 94,714,912 T110S possibly damaging Het
Tnrc6a T C 7: 123,171,495 I836T probably benign Het
Trim30b C A 7: 104,357,362 V96L probably benign Het
Tssk3 TGCTATCATGGGG TG 4: 129,489,313 probably null Het
Tyk2 G T 9: 21,120,526 H418N probably benign Het
Uap1 G T 1: 170,158,903 T170K probably damaging Het
Vmn1r40 T C 6: 89,714,624 V141A not run Het
Vmn1r54 T A 6: 90,269,665 I187K probably damaging Het
Vmp1 C T 11: 86,602,033 V317M probably damaging Het
Wnt8b A G 19: 44,512,072 K366R probably benign Het
Zfp207 C T 11: 80,395,178 P415L unknown Het
Zfp263 A G 16: 3,744,571 E66G probably damaging Het
Zfp985 T A 4: 147,583,456 H260Q probably damaging Het
Zmiz1 A C 14: 25,576,207 Q46P probably damaging Het
Zmiz1 A G 14: 25,576,209 R47G probably damaging Het
Zmiz1 GCC GC 14: 25,576,200 probably null Het
Other mutations in Mpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mpp5 APN 12 78829799 missense possibly damaging 0.89
IGL00863:Mpp5 APN 12 78809821 missense probably damaging 1.00
IGL01860:Mpp5 APN 12 78830907 missense possibly damaging 0.79
R1584:Mpp5 UTSW 12 78829727 missense probably benign 0.34
R1632:Mpp5 UTSW 12 78797038 nonsense probably null
R2117:Mpp5 UTSW 12 78809922 missense possibly damaging 0.81
R2186:Mpp5 UTSW 12 78819371 splice site probably benign
R2211:Mpp5 UTSW 12 78797248 missense possibly damaging 0.78
R4044:Mpp5 UTSW 12 78824839 missense probably benign 0.06
R4224:Mpp5 UTSW 12 78829718 missense probably damaging 1.00
R4535:Mpp5 UTSW 12 78824837 missense possibly damaging 0.90
R5157:Mpp5 UTSW 12 78820815 missense possibly damaging 0.95
R6144:Mpp5 UTSW 12 78824789 missense possibly damaging 0.75
R6180:Mpp5 UTSW 12 78817310 missense probably benign 0.11
R7037:Mpp5 UTSW 12 78797199 missense probably damaging 1.00
R8084:Mpp5 UTSW 12 78820851 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCATGACAACATCATATATGAATGGGC -3'
(R):5'- TCGTTAGGGTATGCAAGGAACC -3'

Sequencing Primer
(F):5'- TCATATATGAATGGGCATGTAACAG -3'
(R):5'- GGAACCAAAGCAAAACATATTGTGC -3'
Posted On2019-06-26