Incidental Mutation 'R7216:Zfp263'
ID561510
Institutional Source Beutler Lab
Gene Symbol Zfp263
Ensembl Gene ENSMUSG00000022529
Gene Namezinc finger protein 263
SynonymsmFPM315, 1200014J04Rik, NT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7216 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location3744093-3750790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3744571 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 66 (E66G)
Ref Sequence ENSEMBL: ENSMUSP00000023176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023176] [ENSMUST00000161630] [ENSMUST00000162207]
Predicted Effect probably damaging
Transcript: ENSMUST00000023176
AA Change: E66G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023176
Gene: ENSMUSG00000022529
AA Change: E66G

DomainStartEndE-ValueType
SCAN 39 151 5.15e-71 SMART
KRAB 219 279 1.86e-9 SMART
ZnF_C2H2 378 400 1.45e-2 SMART
ZnF_C2H2 434 456 3.11e-2 SMART
ZnF_C2H2 462 484 1.2e-3 SMART
ZnF_C2H2 490 512 6.52e-5 SMART
ZnF_C2H2 518 540 1.98e-4 SMART
ZnF_C2H2 572 594 2.4e-3 SMART
ZnF_C2H2 600 622 4.87e-4 SMART
ZnF_C2H2 628 650 1.1e-2 SMART
ZnF_C2H2 656 678 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161630
AA Change: E66G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123725
Gene: ENSMUSG00000022529
AA Change: E66G

DomainStartEndE-ValueType
SCAN 39 143 1.61e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162207
SMART Domains Protein: ENSMUSP00000124433
Gene: ENSMUSG00000022529

DomainStartEndE-ValueType
ZnF_C2H2 90 112 1.45e-2 SMART
ZnF_C2H2 146 168 3.11e-2 SMART
ZnF_C2H2 174 196 1.2e-3 SMART
ZnF_C2H2 202 224 6.52e-5 SMART
ZnF_C2H2 230 252 1.98e-4 SMART
ZnF_C2H2 284 306 2.4e-3 SMART
ZnF_C2H2 312 334 4.87e-4 SMART
ZnF_C2H2 340 362 1.1e-2 SMART
ZnF_C2H2 368 390 1.72e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 53,140,457 N1551K probably benign Het
Amy2a1 T C 3: 113,530,441 D150G possibly damaging Het
Atp2b1 T A 10: 98,986,977 C165S probably benign Het
Atp2c1 A T 9: 105,467,731 D102E probably benign Het
Capn8 C A 1: 182,598,798 R233S possibly damaging Het
Cd48 T C 1: 171,695,822 S78P probably damaging Het
Clasp1 T A 1: 118,547,918 D944E probably benign Het
Clip2 A G 5: 134,502,917 M678T probably benign Het
Clmp T C 9: 40,760,909 Y12H possibly damaging Het
Col22a1 A T 15: 71,973,845 V356D probably damaging Het
Copg2 A T 6: 30,885,600 D101E probably damaging Het
Cpsf6 G A 10: 117,362,023 P229S unknown Het
Dgke T C 11: 89,050,337 D340G probably benign Het
Dlg1 TAAA TAA 16: 31,796,918 probably null Het
Dlg5 G A 14: 24,136,638 Q1865* probably null Het
Dnajc2 C T 5: 21,776,779 R123Q probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Egln2 T C 7: 27,159,829 D365G probably damaging Het
Epha4 T C 1: 77,444,984 D287G probably damaging Het
Fat4 A G 3: 38,891,043 T1362A probably damaging Het
Flt4 A G 11: 49,634,681 T685A possibly damaging Het
Fras1 T C 5: 96,739,314 Y2652H probably damaging Het
Gas2 A G 7: 51,897,257 E52G possibly damaging Het
Gm11639 A T 11: 104,880,549 K2633N possibly damaging Het
Gm13103 A G 4: 143,851,829 I220V probably damaging Het
Gm5093 A T 17: 46,440,088 D4E not run Het
Gm6370 A T 5: 146,493,913 T303S probably benign Het
Gpr161 A G 1: 165,306,546 I126V probably benign Het
Gpr63 T C 4: 25,008,038 L254P probably damaging Het
H2-M9 C T 17: 36,640,702 V294I probably benign Het
Insr T A 8: 3,203,034 N375I possibly damaging Het
Ints1 T C 5: 139,768,984 N600S possibly damaging Het
Ints10 A G 8: 68,822,157 N628S probably damaging Het
Irf2 A G 8: 46,793,556 T20A probably benign Het
Irs1 T A 1: 82,289,755 T247S probably damaging Het
Islr C T 9: 58,156,967 S419N unknown Het
Kcna2 T A 3: 107,104,793 I230N probably damaging Het
Kif3c C A 12: 3,366,126 A49E probably benign Het
Kifap3 A T 1: 163,795,989 K108N probably damaging Het
Lama3 T A 18: 12,430,000 F527I probably damaging Het
Layn A G 9: 51,077,052 probably benign Het
Lims2 G T 18: 31,957,262 W276L probably damaging Het
Lsp1 T C 7: 142,488,442 L133S probably damaging Het
Map3k6 T G 4: 133,246,900 V536G probably damaging Het
Med7 T A 11: 46,440,854 L92H probably damaging Het
Mllt1 A G 17: 56,927,042 V48A probably damaging Het
Mpp5 G A 12: 78,797,232 R70H probably damaging Het
Neurl4 T A 11: 69,910,262 V1153E probably damaging Het
Nkx2-1 A C 12: 56,534,802 C87G probably damaging Het
Nsun7 T C 5: 66,278,657 S291P probably damaging Het
Olfr148 A T 9: 39,614,494 Q309L probably benign Het
Olfr1508 G A 14: 52,463,488 P174S probably damaging Het
Olfr406 A T 11: 74,269,724 I112F probably damaging Het
Olfr46 A T 7: 140,610,460 N90I possibly damaging Het
Olfr829 T A 9: 18,857,336 M237K probably benign Het
Pbrm1 A G 14: 31,045,422 Y331C possibly damaging Het
Pirb T A 7: 3,716,274 T539S probably benign Het
Plch2 T G 4: 154,984,228 T1314P probably benign Het
Polk T C 13: 96,508,220 S133G probably benign Het
Prdm5 A T 6: 65,927,983 K533* probably null Het
Prmt1 T A 7: 44,983,573 Q35H probably benign Het
Pum3 A T 19: 27,424,225 W142R probably damaging Het
Rest G A 5: 77,282,608 R958H probably benign Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Ripor2 G A 13: 24,671,903 G109R probably damaging Het
Sec62 C T 3: 30,818,829 Q354* probably null Het
Snx14 T C 9: 88,381,791 Y847C probably damaging Het
Soga1 T C 2: 157,018,370 R1650G possibly damaging Het
Sox7 A T 14: 63,947,989 D158V probably benign Het
Spag8 A G 4: 43,652,034 V350A possibly damaging Het
Syngr1 A T 15: 80,111,733 I158F probably damaging Het
Tacstd2 C A 6: 67,534,995 V238L probably benign Het
Tex15 T C 8: 33,572,986 S815P possibly damaging Het
Tmem117 A T 15: 94,714,912 T110S possibly damaging Het
Tnrc6a T C 7: 123,171,495 I836T probably benign Het
Trim30b C A 7: 104,357,362 V96L probably benign Het
Tssk3 TGCTATCATGGGG TG 4: 129,489,313 probably null Het
Tyk2 G T 9: 21,120,526 H418N probably benign Het
Uap1 G T 1: 170,158,903 T170K probably damaging Het
Vmn1r40 T C 6: 89,714,624 V141A not run Het
Vmn1r54 T A 6: 90,269,665 I187K probably damaging Het
Vmp1 C T 11: 86,602,033 V317M probably damaging Het
Wnt8b A G 19: 44,512,072 K366R probably benign Het
Zfp207 C T 11: 80,395,178 P415L unknown Het
Zfp985 T A 4: 147,583,456 H260Q probably damaging Het
Zmiz1 GCC GC 14: 25,576,200 probably null Het
Zmiz1 A C 14: 25,576,207 Q46P probably damaging Het
Zmiz1 A G 14: 25,576,209 R47G probably damaging Het
Other mutations in Zfp263
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Zfp263 APN 16 3745846 missense probably benign 0.00
IGL01112:Zfp263 APN 16 3748912 missense probably benign 0.09
IGL02049:Zfp263 APN 16 3744618 missense probably damaging 0.97
IGL02534:Zfp263 APN 16 3746415 unclassified probably benign
IGL02674:Zfp263 APN 16 3746765 unclassified probably benign
IGL03065:Zfp263 APN 16 3746480 missense probably benign
IGL03105:Zfp263 APN 16 3748960 missense probably damaging 1.00
IGL03153:Zfp263 APN 16 3746880 missense possibly damaging 0.56
IGL02796:Zfp263 UTSW 16 3746876 missense probably benign 0.03
R1201:Zfp263 UTSW 16 3749430 missense probably damaging 1.00
R1414:Zfp263 UTSW 16 3749296 missense probably damaging 1.00
R1448:Zfp263 UTSW 16 3746459 missense probably benign 0.18
R3085:Zfp263 UTSW 16 3749716 missense probably damaging 1.00
R4368:Zfp263 UTSW 16 3744906 unclassified probably benign
R4989:Zfp263 UTSW 16 3749128 missense probably damaging 1.00
R5072:Zfp263 UTSW 16 3746840 missense possibly damaging 0.84
R5073:Zfp263 UTSW 16 3746840 missense possibly damaging 0.84
R5074:Zfp263 UTSW 16 3746840 missense possibly damaging 0.84
R5122:Zfp263 UTSW 16 3749855 missense probably damaging 0.99
R5705:Zfp263 UTSW 16 3746454 missense probably benign 0.00
R6140:Zfp263 UTSW 16 3748217 missense probably benign 0.10
R6879:Zfp263 UTSW 16 3749855 missense probably damaging 0.99
R7133:Zfp263 UTSW 16 3749391 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTGTGACCTGGGTTCCTCC -3'
(R):5'- TGCATACGCTCCACAAGAG -3'

Sequencing Primer
(F):5'- ATTTGGAGCCCGGAGTCTCTC -3'
(R):5'- ACAAGAGTGACTGCTTCTTCG -3'
Posted On2019-06-26