Incidental Mutation 'R7217:Asnsd1'
ID561519
Institutional Source Beutler Lab
Gene Symbol Asnsd1
Ensembl Gene ENSMUSG00000026095
Gene Nameasparagine synthetase domain containing 1
Synonyms2210409M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7217 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53344617-53352752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53348193 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 92 (T92A)
Ref Sequence ENSEMBL: ENSMUSP00000027264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027264] [ENSMUST00000123519] [ENSMUST00000144660] [ENSMUST00000147021] [ENSMUST00000154402]
Predicted Effect probably damaging
Transcript: ENSMUST00000027264
AA Change: T92A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027264
Gene: ENSMUSG00000026095
AA Change: T92A

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 2.4e-8 PFAM
Pfam:Asn_synthase 305 388 6.9e-7 PFAM
Pfam:Asn_synthase 505 619 2.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123519
SMART Domains Protein: ENSMUSP00000139025
Gene: ENSMUSG00000026095

DomainStartEndE-ValueType
Pfam:Asn_synthase 2 120 4.5e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144660
AA Change: T92A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139404
Gene: ENSMUSG00000099913
AA Change: T92A

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 1.4e-8 PFAM
Pfam:Asn_synthase 304 565 5.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147021
Predicted Effect probably benign
Transcript: ENSMUST00000154402
Meta Mutation Damage Score 0.2521 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Car14 A G 3: 95,899,317 S250P probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Fcrl5 C T 3: 87,443,774 T197M probably damaging Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gcnt4 T C 13: 96,946,310 L38P probably damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kat7 A G 11: 95,291,564 S237P possibly damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kif20a T A 18: 34,629,560 H495Q probably benign Het
Lama1 A T 17: 67,764,673 T852S Het
Mep1b T A 18: 21,093,543 D487E probably benign Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prl8a2 A G 13: 27,351,015 E91G possibly damaging Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Asnsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Asnsd1 APN 1 53346628 missense probably damaging 1.00
IGL00595:Asnsd1 APN 1 53347488 missense probably damaging 1.00
IGL00705:Asnsd1 APN 1 53348451 missense probably damaging 1.00
IGL01089:Asnsd1 APN 1 53348277 missense probably damaging 1.00
IGL01747:Asnsd1 APN 1 53348095 nonsense probably null
IGL02274:Asnsd1 APN 1 53347575 missense probably benign
R2021:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2022:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2126:Asnsd1 UTSW 1 53347317 missense probably benign 0.00
R2174:Asnsd1 UTSW 1 53347601 missense probably benign 0.44
R4120:Asnsd1 UTSW 1 53347995 missense probably damaging 1.00
R4435:Asnsd1 UTSW 1 53348073 unclassified probably null
R4464:Asnsd1 UTSW 1 53352527 splice site probably null
R4499:Asnsd1 UTSW 1 53347970 missense probably benign
R4622:Asnsd1 UTSW 1 53348219 missense probably benign 0.13
R5090:Asnsd1 UTSW 1 53352404 unclassified probably benign
R5832:Asnsd1 UTSW 1 53347475 missense probably damaging 1.00
R5891:Asnsd1 UTSW 1 53347977 missense probably benign 0.00
R6215:Asnsd1 UTSW 1 53348028 unclassified probably null
R6217:Asnsd1 UTSW 1 53348028 missense probably benign 0.02
R6353:Asnsd1 UTSW 1 53347779 missense probably benign
R6405:Asnsd1 UTSW 1 53347995 missense probably damaging 1.00
R6913:Asnsd1 UTSW 1 53348231 missense probably damaging 0.99
R7570:Asnsd1 UTSW 1 53348258 missense probably damaging 1.00
R7589:Asnsd1 UTSW 1 53347967 missense probably benign 0.00
R7716:Asnsd1 UTSW 1 53347743 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGGCAGAAACTCTTGCCC -3'
(R):5'- TGCTGCATAATCTTAGACGGC -3'

Sequencing Primer
(F):5'- ACTCTTGCCCAGATTACTAAACTG -3'
(R):5'- CATAATCTTAGACGGCGGGGC -3'
Posted On2019-06-26