Incidental Mutation 'R7217:Fcrl5'
ID561524
Institutional Source Beutler Lab
Gene Symbol Fcrl5
Ensembl Gene ENSMUSG00000048031
Gene NameFc receptor-like 5
SynonymsBXMAS1-like protein 2, Fcrh3, mBXMH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7217 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87435773-87500678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87443774 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 197 (T197M)
Ref Sequence ENSEMBL: ENSMUSP00000142210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049926] [ENSMUST00000166297] [ENSMUST00000178261] [ENSMUST00000193229] [ENSMUST00000194102]
Predicted Effect probably damaging
Transcript: ENSMUST00000049926
AA Change: T197M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050151
Gene: ENSMUSG00000048031
AA Change: T197M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166297
AA Change: T109M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131176
Gene: ENSMUSG00000048031
AA Change: T109M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178261
AA Change: T197M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136046
Gene: ENSMUSG00000048031
AA Change: T197M

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193229
AA Change: T109M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141311
Gene: ENSMUSG00000048031
AA Change: T109M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194102
AA Change: T197M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142210
Gene: ENSMUSG00000048031
AA Change: T197M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and the Fc-receptor like family. This gene and several other Fc receptor-like gene members are clustered on the long arm of chromosome 1. The encoded protein is a single-pass type I membrane protein and contains 8 immunoglobulin-like C2-type domains. This gene is implicated in B cell development and lymphomagenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Asnsd1 T C 1: 53,348,193 T92A probably damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Car14 A G 3: 95,899,317 S250P probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gcnt4 T C 13: 96,946,310 L38P probably damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kat7 A G 11: 95,291,564 S237P possibly damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kif20a T A 18: 34,629,560 H495Q probably benign Het
Lama1 A T 17: 67,764,673 T852S Het
Mep1b T A 18: 21,093,543 D487E probably benign Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prl8a2 A G 13: 27,351,015 E91G possibly damaging Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Fcrl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Fcrl5 APN 3 87444291 missense probably damaging 0.96
IGL01868:Fcrl5 APN 3 87443707 missense possibly damaging 0.58
IGL01939:Fcrl5 APN 3 87446299 missense probably damaging 0.99
IGL02817:Fcrl5 APN 3 87435913 missense probably benign 0.35
IGL03106:Fcrl5 APN 3 87435883 unclassified probably null
R0381:Fcrl5 UTSW 3 87446460 missense probably damaging 1.00
R0523:Fcrl5 UTSW 3 87457792 missense possibly damaging 0.72
R0646:Fcrl5 UTSW 3 87442013 missense probably benign 0.00
R1231:Fcrl5 UTSW 3 87442179 missense probably benign 0.13
R1353:Fcrl5 UTSW 3 87448362 missense probably damaging 1.00
R1711:Fcrl5 UTSW 3 87457414 missense possibly damaging 0.61
R1714:Fcrl5 UTSW 3 87446406 missense probably damaging 1.00
R1719:Fcrl5 UTSW 3 87457397 missense probably damaging 0.98
R2084:Fcrl5 UTSW 3 87444230 missense probably benign 0.24
R2358:Fcrl5 UTSW 3 87446419 missense probably damaging 0.99
R2884:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R2885:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R3085:Fcrl5 UTSW 3 87446464 missense probably damaging 1.00
R3153:Fcrl5 UTSW 3 87443680 missense probably benign 0.09
R4288:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4289:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4614:Fcrl5 UTSW 3 87448426 missense probably damaging 1.00
R4719:Fcrl5 UTSW 3 87444189 missense probably damaging 1.00
R4788:Fcrl5 UTSW 3 87457188 missense probably damaging 1.00
R4920:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R4972:Fcrl5 UTSW 3 87454650 missense probably benign 0.00
R5373:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5374:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5963:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R5975:Fcrl5 UTSW 3 87442103 missense probably benign 0.00
R6022:Fcrl5 UTSW 3 87455763 missense probably benign 0.42
R6267:Fcrl5 UTSW 3 87448324 missense probably damaging 1.00
R6372:Fcrl5 UTSW 3 87444194 nonsense probably null
R6393:Fcrl5 UTSW 3 87448327 missense probably damaging 1.00
R7088:Fcrl5 UTSW 3 87457834 makesense probably null
R7175:Fcrl5 UTSW 3 87446338 missense probably benign 0.37
R7210:Fcrl5 UTSW 3 87446412 missense possibly damaging 0.85
R7243:Fcrl5 UTSW 3 87442245 missense probably benign
R7776:Fcrl5 UTSW 3 87444195 missense possibly damaging 0.84
R7813:Fcrl5 UTSW 3 87443623 missense probably benign 0.09
X0054:Fcrl5 UTSW 3 87446299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCTGGTGCTGCAAGCTC -3'
(R):5'- GGTGCTGCTTTTGATTACCCAC -3'

Sequencing Primer
(F):5'- TTCTGAGGTGCTACGCAAAG -3'
(R):5'- TGATTACCCACATCCTCCCAC -3'
Posted On2019-06-26