Incidental Mutation 'R7217:Car14'
ID561525
Institutional Source Beutler Lab
Gene Symbol Car14
Ensembl Gene ENSMUSG00000038526
Gene Namecarbonic anhydrase 14
SynonymsCA XIV
MMRRC Submission
Accession Numbers

Genbank: NM_011797; MGI: 1344341

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7217 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95897768-95904691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95899317 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 250 (S250P)
Ref Sequence ENSEMBL: ENSMUSP00000036983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015894] [ENSMUST00000036181] [ENSMUST00000056710] [ENSMUST00000147962] [ENSMUST00000197081]
PDB Structure
Crystal Structure of the Extracellular Domain of Murine Carbonic Anhydrase XIV [X-RAY DIFFRACTION]
Crystal Structure of the Extracellular Domain of Murine Carbonic Anhydrase XIV in Complex with Acetazolamide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015894
SMART Domains Protein: ENSMUSP00000015894
Gene: ENSMUSG00000015750

DomainStartEndE-ValueType
Pfam:Aph-1 2 246 7.3e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036181
AA Change: S250P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526
AA Change: S250P

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056710
SMART Domains Protein: ENSMUSP00000058846
Gene: ENSMUSG00000015750

DomainStartEndE-ValueType
Pfam:Aph-1 2 239 1.2e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147962
SMART Domains Protein: ENSMUSP00000117464
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 8 171 1.79e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197081
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XIV is predicted to be a type I membrane protein and shares highest sequence similarity with the other transmembrane CA isoform, CA XII; however, they have different patterns of tissue-specific expression and thus may play different physiologic roles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and display normal growth, health and fertility. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Asnsd1 T C 1: 53,348,193 T92A probably damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Fcrl5 C T 3: 87,443,774 T197M probably damaging Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gcnt4 T C 13: 96,946,310 L38P probably damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kat7 A G 11: 95,291,564 S237P possibly damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kif20a T A 18: 34,629,560 H495Q probably benign Het
Lama1 A T 17: 67,764,673 T852S Het
Mep1b T A 18: 21,093,543 D487E probably benign Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prl8a2 A G 13: 27,351,015 E91G possibly damaging Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Car14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Car14 APN 3 95898816 missense probably damaging 1.00
IGL01287:Car14 APN 3 95899559 missense possibly damaging 0.68
IGL01900:Car14 APN 3 95901221 missense probably benign 0.00
IGL02402:Car14 APN 3 95899558 missense possibly damaging 0.92
IGL03152:Car14 APN 3 95898845 missense probably damaging 1.00
R0109:Car14 UTSW 3 95899451 missense probably benign 0.00
R1729:Car14 UTSW 3 95901248 missense possibly damaging 0.90
R4521:Car14 UTSW 3 95904378 utr 5 prime probably benign
R4776:Car14 UTSW 3 95898873 missense probably benign 0.30
R5709:Car14 UTSW 3 95898988 missense possibly damaging 0.60
R6358:Car14 UTSW 3 95898175 missense possibly damaging 0.93
R6895:Car14 UTSW 3 95898160 missense probably benign
R7648:Car14 UTSW 3 95898195 missense probably benign 0.01
R7763:Car14 UTSW 3 95904372 start codon destroyed probably null 0.01
X0026:Car14 UTSW 3 95899209 unclassified probably benign
X0064:Car14 UTSW 3 95901099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCCTGGGGATGATTCC -3'
(R):5'- GAGCAATTCTTCCGCTACAAC -3'

Sequencing Primer
(F):5'- ATTCCCGGTCCAGAGGTGTAC -3'
(R):5'- CGCTACAACGGCTCACTC -3'
Posted On2019-06-26