Incidental Mutation 'R7217:Ccdc138'
ID 561540
Institutional Source Beutler Lab
Gene Symbol Ccdc138
Ensembl Gene ENSMUSG00000038010
Gene Name coiled-coil domain containing 138
Synonyms 6230424H07Rik
MMRRC Submission 045289-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R7217 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 58333770-58412066 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58345422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 138 (I138T)
Ref Sequence ENSEMBL: ENSMUSP00000043040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036576]
AlphaFold Q0VF22
Predicted Effect probably benign
Transcript: ENSMUST00000036576
AA Change: I138T

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043040
Gene: ENSMUSG00000038010
AA Change: I138T

DomainStartEndE-ValueType
coiled coil region 259 339 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,645,188 (GRCm39) H358N probably benign Het
Abcg3 A G 5: 105,087,094 (GRCm39) F543L possibly damaging Het
Asnsd1 T C 1: 53,387,352 (GRCm39) T92A probably damaging Het
Atg2a G T 19: 6,303,471 (GRCm39) probably null Het
Aven T A 2: 112,461,191 (GRCm39) N327K possibly damaging Het
Brd9 T C 13: 74,087,063 (GRCm39) V116A probably damaging Het
Car14 A G 3: 95,806,629 (GRCm39) S250P probably damaging Het
Cmya5 A G 13: 93,226,938 (GRCm39) Y2717H probably damaging Het
Eno1b C A 18: 48,180,746 (GRCm39) T308K probably damaging Het
Epha3 T C 16: 63,372,857 (GRCm39) T949A probably benign Het
Fcrl5 C T 3: 87,351,081 (GRCm39) T197M probably damaging Het
Foxp2 A T 6: 15,416,023 (GRCm39) Q664L unknown Het
Fsip2 A T 2: 82,819,412 (GRCm39) K5048N possibly damaging Het
Gcnt4 T C 13: 97,082,818 (GRCm39) L38P probably damaging Het
Gpr68 A G 12: 100,845,058 (GRCm39) V162A possibly damaging Het
Grin3a A T 4: 49,770,741 (GRCm39) M677K possibly damaging Het
Grm7 A G 6: 111,335,785 (GRCm39) Y732C probably damaging Het
H2-T15 A C 17: 36,367,235 (GRCm39) M329R probably benign Het
Hoxb4 A G 11: 96,209,906 (GRCm39) E104G probably benign Het
Kat7 A G 11: 95,182,390 (GRCm39) S237P possibly damaging Het
Kif13b T C 14: 65,010,517 (GRCm39) V1272A probably damaging Het
Kif20a T A 18: 34,762,613 (GRCm39) H495Q probably benign Het
Lama1 A T 17: 68,071,668 (GRCm39) T852S Het
Mep1b T A 18: 21,226,600 (GRCm39) D487E probably benign Het
Mki67 T C 7: 135,305,911 (GRCm39) T656A probably damaging Het
Mlh3 A G 12: 85,313,481 (GRCm39) W902R probably benign Het
Muc16 A T 9: 18,555,372 (GRCm39) Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Pkd1l2 A G 8: 117,722,536 (GRCm39) I2424T probably benign Het
Prl8a2 A G 13: 27,534,998 (GRCm39) E91G possibly damaging Het
Prpf18 A G 2: 4,650,435 (GRCm39) V65A probably benign Het
Pxmp2 A G 5: 110,433,771 (GRCm39) V34A probably damaging Het
Ranbp2 T G 10: 58,287,839 (GRCm39) Y36D probably damaging Het
Rbm25 G A 12: 83,710,991 (GRCm39) R368Q unknown Het
Rims2 C A 15: 39,339,885 (GRCm39) L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,229,139 (GRCm39) probably benign Het
Scn8a A T 15: 100,868,108 (GRCm39) M318L probably benign Het
Slc35b2 A G 17: 45,875,955 (GRCm39) T55A probably benign Het
Trnp1 T C 4: 133,225,416 (GRCm39) E118G possibly damaging Het
Ttll13 A C 7: 79,903,911 (GRCm39) K280Q probably damaging Het
Wdfy3 A T 5: 102,049,785 (GRCm39) H1680Q probably damaging Het
Zfp131 A G 13: 120,237,377 (GRCm39) I327T probably damaging Het
Zfp729b A G 13: 67,743,367 (GRCm39) V66A probably damaging Het
Other mutations in Ccdc138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc138 APN 10 58,411,537 (GRCm39) missense probably damaging 1.00
IGL00957:Ccdc138 APN 10 58,364,838 (GRCm39) splice site probably benign
IGL01012:Ccdc138 APN 10 58,376,737 (GRCm39) critical splice donor site probably null
IGL01725:Ccdc138 APN 10 58,364,745 (GRCm39) missense possibly damaging 0.50
IGL01996:Ccdc138 APN 10 58,397,852 (GRCm39) missense probably damaging 1.00
IGL02083:Ccdc138 APN 10 58,380,736 (GRCm39) splice site probably benign
IGL02652:Ccdc138 APN 10 58,348,901 (GRCm39) missense probably benign 0.00
IGL02820:Ccdc138 APN 10 58,364,721 (GRCm39) splice site probably benign
IGL02934:Ccdc138 APN 10 58,409,402 (GRCm39) splice site probably benign
IGL03231:Ccdc138 APN 10 58,409,528 (GRCm39) missense probably damaging 1.00
R0128:Ccdc138 UTSW 10 58,364,182 (GRCm39) missense probably damaging 1.00
R0271:Ccdc138 UTSW 10 58,411,645 (GRCm39) missense probably damaging 0.99
R0480:Ccdc138 UTSW 10 58,397,789 (GRCm39) missense probably damaging 1.00
R0560:Ccdc138 UTSW 10 58,411,539 (GRCm39) missense probably damaging 1.00
R0645:Ccdc138 UTSW 10 58,411,542 (GRCm39) missense probably damaging 1.00
R1405:Ccdc138 UTSW 10 58,380,939 (GRCm39) splice site probably benign
R2032:Ccdc138 UTSW 10 58,348,984 (GRCm39) missense possibly damaging 0.71
R2097:Ccdc138 UTSW 10 58,397,759 (GRCm39) nonsense probably null
R2350:Ccdc138 UTSW 10 58,397,715 (GRCm39) splice site probably benign
R2571:Ccdc138 UTSW 10 58,349,044 (GRCm39) missense probably benign 0.25
R3787:Ccdc138 UTSW 10 58,374,092 (GRCm39) missense probably damaging 1.00
R3805:Ccdc138 UTSW 10 58,397,819 (GRCm39) missense possibly damaging 0.95
R4582:Ccdc138 UTSW 10 58,343,465 (GRCm39) critical splice donor site probably null
R4630:Ccdc138 UTSW 10 58,409,477 (GRCm39) missense probably damaging 1.00
R4801:Ccdc138 UTSW 10 58,409,465 (GRCm39) missense probably damaging 1.00
R4802:Ccdc138 UTSW 10 58,409,465 (GRCm39) missense probably damaging 1.00
R4883:Ccdc138 UTSW 10 58,397,818 (GRCm39) missense probably benign 0.03
R4908:Ccdc138 UTSW 10 58,380,817 (GRCm39) missense possibly damaging 0.84
R5032:Ccdc138 UTSW 10 58,409,458 (GRCm39) missense probably damaging 1.00
R5155:Ccdc138 UTSW 10 58,343,394 (GRCm39) missense probably benign 0.00
R5287:Ccdc138 UTSW 10 58,411,527 (GRCm39) missense possibly damaging 0.89
R5683:Ccdc138 UTSW 10 58,376,641 (GRCm39) missense probably damaging 1.00
R5963:Ccdc138 UTSW 10 58,411,579 (GRCm39) missense possibly damaging 0.90
R6530:Ccdc138 UTSW 10 58,380,790 (GRCm39) missense probably damaging 1.00
R7148:Ccdc138 UTSW 10 58,374,102 (GRCm39) missense probably damaging 1.00
R9031:Ccdc138 UTSW 10 58,380,893 (GRCm39) missense probably damaging 1.00
R9080:Ccdc138 UTSW 10 58,397,884 (GRCm39) missense probably damaging 0.99
R9104:Ccdc138 UTSW 10 58,348,982 (GRCm39) missense probably benign 0.05
R9134:Ccdc138 UTSW 10 58,374,102 (GRCm39) missense probably damaging 0.99
R9300:Ccdc138 UTSW 10 58,343,448 (GRCm39) missense probably benign 0.00
R9409:Ccdc138 UTSW 10 58,374,135 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTTGCTATCTGAAAAGCAG -3'
(R):5'- GTTTTGAGAATGGAAGAACACAACC -3'

Sequencing Primer
(F):5'- GTTGCTATCTGAAAAGCAGTTTTG -3'
(R):5'- TCCTTTAACTTCACCACAAGTACAG -3'
Posted On 2019-06-26