Incidental Mutation 'R7217:Kat7'
ID561541
Institutional Source Beutler Lab
Gene Symbol Kat7
Ensembl Gene ENSMUSG00000038909
Gene NameK(lysine) acetyltransferase 7
SynonymsMyst2, Hboa, Hbo1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7217 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95274259-95310246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95291564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 237 (S237P)
Ref Sequence ENSEMBL: ENSMUSP00000103362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072621] [ENSMUST00000092766] [ENSMUST00000103159] [ENSMUST00000107733] [ENSMUST00000107734]
Predicted Effect probably benign
Transcript: ENSMUST00000072621
SMART Domains Protein: ENSMUSP00000072416
Gene: ENSMUSG00000038909

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 184 214 3.2e-17 PFAM
ZnF_C2H2 338 364 1.86e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092766
AA Change: S239P

PolyPhen 2 Score 0.567 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090441
Gene: ENSMUSG00000038909
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 186 214 1.2e-16 PFAM
ZnF_C2H2 368 394 1.86e1 SMART
Pfam:MOZ_SAS 395 573 7.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103159
SMART Domains Protein: ENSMUSP00000099448
Gene: ENSMUSG00000038909

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
Pfam:zf-C2HC 123 153 2.8e-17 PFAM
ZnF_C2H2 277 303 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107733
SMART Domains Protein: ENSMUSP00000103361
Gene: ENSMUSG00000038909

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.3e-17 PFAM
ZnF_C2H2 336 362 1.86e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107734
AA Change: S237P

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103362
Gene: ENSMUSG00000038909
AA Change: S237P

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.5e-17 PFAM
ZnF_C2H2 366 392 1.86e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the multimeric HBO1 complex, which possesses histone H4-specific acetyltransferase activity. This activity is required for functional replication origins and is involved in transcriptional activation of some genes. In both cases, the acetylation of histone H4 helps unfold chromatin so that the DNA can be accessed and replicated or transcribed. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic growth arrest, incomplete embryo turning, disorganized yolk sac vascular plexus, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Asnsd1 T C 1: 53,348,193 T92A probably damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Car14 A G 3: 95,899,317 S250P probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Fcrl5 C T 3: 87,443,774 T197M probably damaging Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gcnt4 T C 13: 96,946,310 L38P probably damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kif20a T A 18: 34,629,560 H495Q probably benign Het
Lama1 A T 17: 67,764,673 T852S Het
Mep1b T A 18: 21,093,543 D487E probably benign Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prl8a2 A G 13: 27,351,015 E91G possibly damaging Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Kat7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Kat7 APN 11 95306133 missense probably benign 0.01
IGL03287:Kat7 APN 11 95300109 missense probably damaging 1.00
R0047:Kat7 UTSW 11 95300208 missense probably benign 0.07
R0578:Kat7 UTSW 11 95291524 missense probably benign 0.00
R1739:Kat7 UTSW 11 95276547 missense possibly damaging 0.85
R2038:Kat7 UTSW 11 95300102 missense probably benign 0.14
R2115:Kat7 UTSW 11 95303294 missense probably benign 0.10
R2214:Kat7 UTSW 11 95275805 missense probably damaging 0.99
R2355:Kat7 UTSW 11 95291581 missense probably benign
R3425:Kat7 UTSW 11 95303165 missense probably damaging 1.00
R3775:Kat7 UTSW 11 95291531 missense probably benign 0.00
R3811:Kat7 UTSW 11 95291615 splice site probably benign
R4066:Kat7 UTSW 11 95284141 missense possibly damaging 0.93
R4169:Kat7 UTSW 11 95280472 missense probably damaging 0.99
R4657:Kat7 UTSW 11 95277598 missense probably damaging 1.00
R4814:Kat7 UTSW 11 95303123 splice site probably benign
R5186:Kat7 UTSW 11 95286416 missense probably benign 0.00
R6015:Kat7 UTSW 11 95284034 missense probably damaging 1.00
R6820:Kat7 UTSW 11 95284139 missense probably damaging 1.00
R6894:Kat7 UTSW 11 95284084 missense possibly damaging 0.86
R7192:Kat7 UTSW 11 95275830 missense probably benign 0.00
R7728:Kat7 UTSW 11 95300081 missense probably benign 0.25
R7999:Kat7 UTSW 11 95284109 missense probably damaging 1.00
R8230:Kat7 UTSW 11 95277589 missense probably damaging 1.00
R8747:Kat7 UTSW 11 95294566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCAGTGATTTTGATTTGTCCTG -3'
(R):5'- GGCCAAGATAGCACTGTGTG -3'

Sequencing Primer
(F):5'- TTTGTCCTGGAAACCAAAGGC -3'
(R):5'- GTGGGGCTTGCCTCATC -3'
Posted On2019-06-26