Mutagenetix > Incidental Mutation

Incidental Mutation 'R7217:Mlh3'

561544

Institutional Source

Beutler Lab

Gene Symbol

Mlh3

Ensembl Gene

ENSMUSG00000021245

Gene Name

mutL homolog 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7217 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85234520-85270599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85266707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 902 (W902R)

Ref Sequence

ENSEMBL: ENSMUSP00000019378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019378] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]

AlphaFold

A0A1Y7VMP7

Predicted Effect

probably benign
Transcript: ENSMUST00000019378
AA Change: W902R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: W902R

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166821
AA Change: W902R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: W902R

Domain	Start	End	E-Value	Type
HATPase_c	17	125	1.04e0	SMART
DNA_mis_repair	211	349	8.78e-22	SMART
low complexity region	582	594	N/A	INTRINSIC
low complexity region	658	671	N/A	INTRINSIC
low complexity region	863	882	N/A	INTRINSIC
low complexity region	1078	1096	N/A	INTRINSIC
MutL_C	1153	1334	7.45e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220854
AA Change: W902R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000223230

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

91% (40/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	C	A	5: 138,646,926	H358N	probably benign	Het
Abcg3	A	G	5: 104,939,228	F543L	possibly damaging	Het
Asnsd1	T	C	1: 53,348,193	T92A	probably damaging	Het
Atg2a	G	T	19: 6,253,441		probably null	Het
Aven	T	A	2: 112,630,846	N327K	possibly damaging	Het
Brd9	T	C	13: 73,938,944	V116A	probably damaging	Het
Car14	A	G	3: 95,899,317	S250P	probably damaging	Het
Ccdc138	T	C	10: 58,509,600	I138T	probably benign	Het
Cmya5	A	G	13: 93,090,430	Y2717H	probably damaging	Het
Eno1b	C	A	18: 48,047,679	T308K	probably damaging	Het
Epha3	T	C	16: 63,552,494	T949A	probably benign	Het
Fcrl5	C	T	3: 87,443,774	T197M	probably damaging	Het
Foxp2	A	T	6: 15,416,024	Q664L	unknown	Het
Fsip2	A	T	2: 82,989,068	K5048N	possibly damaging	Het
Gcnt4	T	C	13: 96,946,310	L38P	probably damaging	Het
Gm11127	A	C	17: 36,056,343	M329R	probably benign	Het
Gpr68	A	G	12: 100,878,799	V162A	possibly damaging	Het
Grin3a	A	T	4: 49,770,741	M677K	possibly damaging	Het
Grm7	A	G	6: 111,358,824	Y732C	probably damaging	Het
Hoxb4	A	G	11: 96,319,080	E104G	probably benign	Het
Kat7	A	G	11: 95,291,564	S237P	possibly damaging	Het
Kif13b	T	C	14: 64,773,068	V1272A	probably damaging	Het
Kif20a	T	A	18: 34,629,560	H495Q	probably benign	Het
Lama1	A	T	17: 67,764,673	T852S		Het
Mep1b	T	A	18: 21,093,543	D487E	probably benign	Het
Mki67	T	C	7: 135,704,182	T656A	probably damaging	Het
Muc16	A	T	9: 18,644,076	Y3640*	probably null	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Pkd1l2	A	G	8: 116,995,797	I2424T	probably benign	Het
Prl8a2	A	G	13: 27,351,015	E91G	possibly damaging	Het
Prpf18	A	G	2: 4,645,624	V65A	probably benign	Het
Pxmp2	A	G	5: 110,285,905	V34A	probably damaging	Het
Ranbp2	T	G	10: 58,452,017	Y36D	probably damaging	Het
Rbm25	G	A	12: 83,664,217	R368Q	unknown	Het
Rims2	C	A	15: 39,476,489	L860M	probably damaging	Het
Rsf1	CGGC	CGGCGGCGGGGGC	7: 97,579,932		probably benign	Het
Scn8a	A	T	15: 100,970,227	M318L	probably benign	Het
Slc35b2	A	G	17: 45,565,029	T55A	probably benign	Het
Trnp1	T	C	4: 133,498,105	E118G	possibly damaging	Het
Ttll13	A	C	7: 80,254,163	K280Q	probably damaging	Het
Wdfy3	A	T	5: 101,901,919	H1680Q	probably damaging	Het
Zfp131	A	G	13: 119,775,841	I327T	probably damaging	Het
Zfp729b	A	G	13: 67,595,248	V66A	probably damaging	Het

Other mutations in Mlh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Mlh3	APN	12	85267929	missense	probably benign
IGL01462:Mlh3	APN	12	85266736	missense	probably benign
IGL01961:Mlh3	APN	12	85266344	missense	probably benign	0.00
IGL02596:Mlh3	APN	12	85240958	critical splice donor site	probably null
IGL03008:Mlh3	APN	12	85240851	missense	probably benign	0.23
IGL03142:Mlh3	APN	12	85250301	critical splice donor site	probably null
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0032:Mlh3	UTSW	12	85245749	intron	probably benign
R0078:Mlh3	UTSW	12	85268818	missense	probably damaging	0.98
R0129:Mlh3	UTSW	12	85266140	splice site	probably benign
R0269:Mlh3	UTSW	12	85268405	missense	probably benign	0.00
R0393:Mlh3	UTSW	12	85267587	nonsense	probably null
R0403:Mlh3	UTSW	12	85268968	missense	possibly damaging	0.93
R0409:Mlh3	UTSW	12	85240854	missense	possibly damaging	0.95
R0587:Mlh3	UTSW	12	85266419	missense	probably benign	0.00
R0701:Mlh3	UTSW	12	85267903	missense	probably benign	0.00
R0718:Mlh3	UTSW	12	85247697	missense	possibly damaging	0.86
R0883:Mlh3	UTSW	12	85235714	missense	possibly damaging	0.89
R0989:Mlh3	UTSW	12	85269395	missense	probably benign	0.22
R0990:Mlh3	UTSW	12	85267765	missense	probably benign
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1467:Mlh3	UTSW	12	85237600	nonsense	probably null
R1562:Mlh3	UTSW	12	85266920	missense	probably benign	0.14
R1599:Mlh3	UTSW	12	85268369	missense	probably damaging	1.00
R1694:Mlh3	UTSW	12	85267141	missense	probably damaging	1.00
R1777:Mlh3	UTSW	12	85268754	missense	possibly damaging	0.75
R1822:Mlh3	UTSW	12	85266145	splice site	probably benign
R1874:Mlh3	UTSW	12	85237513	critical splice donor site	probably null
R1914:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R1915:Mlh3	UTSW	12	85261668	missense	probably benign	0.08
R2075:Mlh3	UTSW	12	85269141	nonsense	probably null
R2083:Mlh3	UTSW	12	85269041	missense	probably benign	0.16
R2267:Mlh3	UTSW	12	85260811	missense	possibly damaging	0.55
R2334:Mlh3	UTSW	12	85268077	missense	probably benign	0.00
R2882:Mlh3	UTSW	12	85267566	missense	probably damaging	1.00
R3623:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3624:Mlh3	UTSW	12	85268395	missense	probably damaging	1.00
R3963:Mlh3	UTSW	12	85268680	missense	possibly damaging	0.94
R4376:Mlh3	UTSW	12	85259198	missense	probably benign	0.00
R5334:Mlh3	UTSW	12	85245761	critical splice donor site	probably null
R5526:Mlh3	UTSW	12	85269373	nonsense	probably null
R5556:Mlh3	UTSW	12	85268493	nonsense	probably null
R5611:Mlh3	UTSW	12	85267445	missense	probably benign	0.21
R5911:Mlh3	UTSW	12	85268455	missense	probably damaging	1.00
R6050:Mlh3	UTSW	12	85240846	missense	possibly damaging	0.89
R6221:Mlh3	UTSW	12	85268418	missense	possibly damaging	0.94
R6377:Mlh3	UTSW	12	85268497	missense	probably damaging	0.97
R6820:Mlh3	UTSW	12	85247723	missense	probably damaging	1.00
R6826:Mlh3	UTSW	12	85245824	missense	probably benign	0.38
R6992:Mlh3	UTSW	12	85235720	missense	probably damaging	1.00
R7228:Mlh3	UTSW	12	85235656	missense	probably benign	0.07
R7348:Mlh3	UTSW	12	85267441	missense	probably damaging	0.99
R7599:Mlh3	UTSW	12	85268199	nonsense	probably null
R7722:Mlh3	UTSW	12	85267492	missense	probably benign	0.01
R7762:Mlh3	UTSW	12	85268284	missense	possibly damaging	0.63
R7786:Mlh3	UTSW	12	85266737	missense	probably benign	0.00
R8231:Mlh3	UTSW	12	85260798	critical splice donor site	probably null
R8415:Mlh3	UTSW	12	85269080	missense	probably benign	0.35
R8750:Mlh3	UTSW	12	85261714	missense	probably damaging	0.99
R8794:Mlh3	UTSW	12	85235723	missense	probably damaging	1.00
R9301:Mlh3	UTSW	12	85245839	missense	possibly damaging	0.77
R9385:Mlh3	UTSW	12	85269370	missense	probably damaging	1.00
R9518:Mlh3	UTSW	12	85266230	missense	probably benign	0.00
R9549:Mlh3	UTSW	12	85266475	missense	probably benign	0.01
RF014:Mlh3	UTSW	12	85268029	missense	probably benign
X0024:Mlh3	UTSW	12	85247669	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCAAAGGAGTTTCTGGTTTC -3'
(R):5'- GAAGATCGCTTAGAACAGATGC -3'

Sequencing Primer
(F):5'- CAAAGGAGTTTCTGGTTTCTCTGTG -3'
(R):5'- CGCTTAGAACAGATGCCTCATTTGAG -3'

Posted On

2019-06-26