Incidental Mutation 'R7217:Gcnt4'
ID561550
Institutional Source Beutler Lab
Gene Symbol Gcnt4
Ensembl Gene ENSMUSG00000091387
Gene Nameglucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
SynonymsLOC218476, LOC238786, Gm73, C2GNT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7217 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location96924689-96950906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96946310 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 38 (L38P)
Ref Sequence ENSEMBL: ENSMUSP00000130496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171324]
Predicted Effect probably damaging
Transcript: ENSMUST00000171324
AA Change: L38P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130496
Gene: ENSMUSG00000091387
AA Change: L38P

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:Branch 134 403 1.1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display neutrophilia, increased aggression towards males, reduced serum thyroxine levels, and altered O-glycan structures in the stomach, colon, and small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Asnsd1 T C 1: 53,348,193 T92A probably damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Car14 A G 3: 95,899,317 S250P probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Fcrl5 C T 3: 87,443,774 T197M probably damaging Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kat7 A G 11: 95,291,564 S237P possibly damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kif20a T A 18: 34,629,560 H495Q probably benign Het
Lama1 A T 17: 67,764,673 T852S Het
Mep1b T A 18: 21,093,543 D487E probably benign Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prl8a2 A G 13: 27,351,015 E91G possibly damaging Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Gcnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Gcnt4 APN 13 96946556 missense probably damaging 1.00
IGL02677:Gcnt4 APN 13 96947233 missense probably benign
IGL02936:Gcnt4 APN 13 96946411 missense probably benign 0.00
R0332:Gcnt4 UTSW 13 96946510 missense probably benign 0.01
R0741:Gcnt4 UTSW 13 96946432 nonsense probably null
R0853:Gcnt4 UTSW 13 96946835 missense probably damaging 1.00
R2156:Gcnt4 UTSW 13 96946466 missense probably damaging 0.99
R3837:Gcnt4 UTSW 13 96947014 nonsense probably null
R3838:Gcnt4 UTSW 13 96947014 nonsense probably null
R3839:Gcnt4 UTSW 13 96947014 nonsense probably null
R4434:Gcnt4 UTSW 13 96946342 missense probably benign 0.00
R4611:Gcnt4 UTSW 13 96946482 missense probably benign
R4782:Gcnt4 UTSW 13 96947406 missense possibly damaging 0.88
R5853:Gcnt4 UTSW 13 96946652 missense probably benign 0.01
R6013:Gcnt4 UTSW 13 96947278 missense possibly damaging 0.95
R6139:Gcnt4 UTSW 13 96946852 missense probably benign 0.16
R6329:Gcnt4 UTSW 13 96947273 missense probably damaging 1.00
R7131:Gcnt4 UTSW 13 96946519 missense probably damaging 0.98
R7497:Gcnt4 UTSW 13 96946960 missense possibly damaging 0.52
R7509:Gcnt4 UTSW 13 96947170 missense probably benign 0.28
R7592:Gcnt4 UTSW 13 96947161 missense probably benign 0.02
R8673:Gcnt4 UTSW 13 96946489 missense probably benign 0.24
Z1177:Gcnt4 UTSW 13 96946453 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGTGCAGTAGGTGGTACC -3'
(R):5'- CTCCAAGTCGATGATGCTCC -3'

Sequencing Primer
(F):5'- TAGGTGGTACCCAGTAAACTTG -3'
(R):5'- AAGTCGATGATGCTCCGTCTTCTG -3'
Posted On2019-06-26