Incidental Mutation 'R7217:Mep1b'
ID561559
Institutional Source Beutler Lab
Gene Symbol Mep1b
Ensembl Gene ENSMUSG00000024313
Gene Namemeprin 1 beta
SynonymsMep-1b, meprin beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R7217 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location21072344-21100199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21093543 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 487 (D487E)
Ref Sequence ENSEMBL: ENSMUSP00000080866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082235]
Predicted Effect probably benign
Transcript: ENSMUST00000082235
AA Change: D487E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080866
Gene: ENSMUSG00000024313
AA Change: D487E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 42 N/A INTRINSIC
ZnMc 68 208 1.23e-54 SMART
MAM 261 430 1.91e-52 SMART
MATH 433 569 4.88e-8 SMART
EGF 610 647 2.35e-2 SMART
transmembrane domain 658 680 N/A INTRINSIC
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meprins are multidomain zinc metalloproteases that are highly expressed in mammalian kidney and intestinal brush border membranes, and in leukocytes and certain cancer cells. They are involved in the hydrolysis of a variety of peptide and protein substrates, and have been implicated in cancer and intestinal inflammation. Mature meprins are oligomers of evolutionarily related, but separately encoded alpha and/or beta subunits. Homooligomers of alpha subunit are secreted, whereas, oligomers containing the beta subunit are plasma membrane-bound. This gene encodes the beta subunit. Targeted disruption of this gene in mice affects embryonic viability, renal gene expression profiles, and distribution of the membrane-associated alpha subunit in kidney and intestine. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit 50% prenatal lethality; survivors have reduced birth weight and show altered renal gene expression, but otherwise are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Asnsd1 T C 1: 53,348,193 T92A probably damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Car14 A G 3: 95,899,317 S250P probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Fcrl5 C T 3: 87,443,774 T197M probably damaging Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gcnt4 T C 13: 96,946,310 L38P probably damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kat7 A G 11: 95,291,564 S237P possibly damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Kif20a T A 18: 34,629,560 H495Q probably benign Het
Lama1 A T 17: 67,764,673 T852S Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prl8a2 A G 13: 27,351,015 E91G possibly damaging Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Mep1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Mep1b APN 18 21084186 nonsense probably null
IGL01470:Mep1b APN 18 21097467 missense probably benign 0.26
IGL01866:Mep1b APN 18 21094993 missense probably benign 0.34
IGL02865:Mep1b APN 18 21093384 missense probably benign 0.02
IGL03093:Mep1b APN 18 21093653 missense probably benign 0.01
IGL03126:Mep1b APN 18 21088560 missense probably damaging 1.00
IGL03196:Mep1b APN 18 21095064 missense probably benign 0.01
P0022:Mep1b UTSW 18 21088541 splice site probably benign
R0143:Mep1b UTSW 18 21095107 splice site probably benign
R0743:Mep1b UTSW 18 21080458 missense possibly damaging 0.81
R0961:Mep1b UTSW 18 21088729 nonsense probably null
R1913:Mep1b UTSW 18 21093229 missense probably benign 0.21
R2162:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R2307:Mep1b UTSW 18 21088575 missense probably damaging 1.00
R3000:Mep1b UTSW 18 21093304 missense probably damaging 0.96
R3833:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R3862:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3863:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3864:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R4171:Mep1b UTSW 18 21095106 splice site probably null
R4774:Mep1b UTSW 18 21086184 missense probably benign 0.24
R4798:Mep1b UTSW 18 21093254 missense probably damaging 0.99
R5411:Mep1b UTSW 18 21086249 missense probably damaging 1.00
R6952:Mep1b UTSW 18 21088670 missense probably benign 0.00
R7056:Mep1b UTSW 18 21091190 missense probably damaging 1.00
R7078:Mep1b UTSW 18 21100051 missense probably benign 0.35
R7641:Mep1b UTSW 18 21094977 missense possibly damaging 0.47
R7843:Mep1b UTSW 18 21095053 missense probably damaging 1.00
R8103:Mep1b UTSW 18 21089385 missense possibly damaging 0.56
R8794:Mep1b UTSW 18 21091268 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCATCAGGTGGTCTGTCTATC -3'
(R):5'- CTCCTTGAACAATCATCATGGCC -3'

Sequencing Primer
(F):5'- GGTCTGTCTATCGATGACATCAATC -3'
(R):5'- TTGAACAATCATCATGGCCCTAGC -3'
Posted On2019-06-26