Incidental Mutation 'R7217:Kif20a'
ID561560
Institutional Source Beutler Lab
Gene Symbol Kif20a
Ensembl Gene ENSMUSG00000003779
Gene Namekinesin family member 20A
SynonymsRabkinesin-6, Rab6kifl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7217 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34624624-34633265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34629560 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 495 (H495Q)
Ref Sequence ENSEMBL: ENSMUSP00000132659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003876] [ENSMUST00000025228] [ENSMUST00000097626] [ENSMUST00000115765] [ENSMUST00000115766] [ENSMUST00000133181] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably benign
Transcript: ENSMUST00000003876
SMART Domains Protein: ENSMUSP00000003876
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025228
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097626
SMART Domains Protein: ENSMUSP00000095229
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 3e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
BROMO 705 813 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115765
SMART Domains Protein: ENSMUSP00000111431
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 5e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115766
SMART Domains Protein: ENSMUSP00000111432
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 337 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
BROMO 708 816 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133181
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166044
AA Change: H495Q

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779
AA Change: H495Q

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167161
AA Change: H495Q

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779
AA Change: H495Q

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Meta Mutation Damage Score 0.0673 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik C A 5: 138,646,926 H358N probably benign Het
Abcg3 A G 5: 104,939,228 F543L possibly damaging Het
Asnsd1 T C 1: 53,348,193 T92A probably damaging Het
Atg2a G T 19: 6,253,441 probably null Het
Aven T A 2: 112,630,846 N327K possibly damaging Het
Brd9 T C 13: 73,938,944 V116A probably damaging Het
Car14 A G 3: 95,899,317 S250P probably damaging Het
Ccdc138 T C 10: 58,509,600 I138T probably benign Het
Cmya5 A G 13: 93,090,430 Y2717H probably damaging Het
Eno1b C A 18: 48,047,679 T308K probably damaging Het
Epha3 T C 16: 63,552,494 T949A probably benign Het
Fcrl5 C T 3: 87,443,774 T197M probably damaging Het
Foxp2 A T 6: 15,416,024 Q664L unknown Het
Fsip2 A T 2: 82,989,068 K5048N possibly damaging Het
Gcnt4 T C 13: 96,946,310 L38P probably damaging Het
Gm11127 A C 17: 36,056,343 M329R probably benign Het
Gpr68 A G 12: 100,878,799 V162A possibly damaging Het
Grin3a A T 4: 49,770,741 M677K possibly damaging Het
Grm7 A G 6: 111,358,824 Y732C probably damaging Het
Hoxb4 A G 11: 96,319,080 E104G probably benign Het
Kat7 A G 11: 95,291,564 S237P possibly damaging Het
Kif13b T C 14: 64,773,068 V1272A probably damaging Het
Lama1 A T 17: 67,764,673 T852S Het
Mep1b T A 18: 21,093,543 D487E probably benign Het
Mki67 T C 7: 135,704,182 T656A probably damaging Het
Mlh3 A G 12: 85,266,707 W902R probably benign Het
Muc16 A T 9: 18,644,076 Y3640* probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pkd1l2 A G 8: 116,995,797 I2424T probably benign Het
Prl8a2 A G 13: 27,351,015 E91G possibly damaging Het
Prpf18 A G 2: 4,645,624 V65A probably benign Het
Pxmp2 A G 5: 110,285,905 V34A probably damaging Het
Ranbp2 T G 10: 58,452,017 Y36D probably damaging Het
Rbm25 G A 12: 83,664,217 R368Q unknown Het
Rims2 C A 15: 39,476,489 L860M probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Scn8a A T 15: 100,970,227 M318L probably benign Het
Slc35b2 A G 17: 45,565,029 T55A probably benign Het
Trnp1 T C 4: 133,498,105 E118G possibly damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Wdfy3 A T 5: 101,901,919 H1680Q probably damaging Het
Zfp131 A G 13: 119,775,841 I327T probably damaging Het
Zfp729b A G 13: 67,595,248 V66A probably damaging Het
Other mutations in Kif20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02448:Kif20a APN 18 34628454 missense possibly damaging 0.49
IGL02654:Kif20a APN 18 34632023 missense probably damaging 1.00
IGL02739:Kif20a APN 18 34628943 nonsense probably null
R0600:Kif20a UTSW 18 34629209 missense probably damaging 1.00
R0748:Kif20a UTSW 18 34628188 splice site probably benign
R0856:Kif20a UTSW 18 34631218 missense probably benign
R1278:Kif20a UTSW 18 34626777 missense probably benign 0.00
R1752:Kif20a UTSW 18 34631581 missense possibly damaging 0.82
R2036:Kif20a UTSW 18 34628462 missense possibly damaging 0.91
R2143:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R2144:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R4231:Kif20a UTSW 18 34632038 missense probably benign
R4372:Kif20a UTSW 18 34629478 missense probably damaging 1.00
R4426:Kif20a UTSW 18 34631941 missense probably damaging 1.00
R4584:Kif20a UTSW 18 34632611 missense probably damaging 1.00
R5524:Kif20a UTSW 18 34630625 critical splice donor site probably null
R5867:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5869:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5949:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5958:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5959:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5967:Kif20a UTSW 18 34630527 missense probably benign 0.10
R5969:Kif20a UTSW 18 34632415 missense probably benign 0.01
R6175:Kif20a UTSW 18 34628146 missense probably damaging 0.98
R6490:Kif20a UTSW 18 34629490 missense possibly damaging 0.84
R6694:Kif20a UTSW 18 34625526 missense probably damaging 0.98
R6866:Kif20a UTSW 18 34628493 missense probably benign 0.10
R7129:Kif20a UTSW 18 34632535 missense probably benign 0.00
R7397:Kif20a UTSW 18 34627676 missense probably damaging 1.00
R7585:Kif20a UTSW 18 34625538 missense probably benign 0.03
R8302:Kif20a UTSW 18 34631977 missense probably damaging 1.00
R8306:Kif20a UTSW 18 34628391 missense probably benign 0.00
R8325:Kif20a UTSW 18 34626922 missense possibly damaging 0.68
R8697:Kif20a UTSW 18 34628531 missense probably benign 0.19
X0027:Kif20a UTSW 18 34625530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGCACTTATACTCACAATGC -3'
(R):5'- GAGCTATTTTAAGATTGCCAGTCC -3'

Sequencing Primer
(F):5'- TGCTTTTTATCTGATTCTGTACAAGG -3'
(R):5'- TAAGATTGCCAGTCCTGCGG -3'
Posted On2019-06-26