Mutagenetix > Incidental Mutation

Incidental Mutation 'R7218:Apcs'

561566

Institutional Source

Beutler Lab

Gene Symbol

Apcs

Ensembl Gene

ENSMUSG00000026542

Gene Name

serum amyloid P-component

Synonyms

Sap

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R7218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

172893961-172895041 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 172894664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 38 (D38E)

Ref Sequence

ENSEMBL: ENSMUSP00000027824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027824]

AlphaFold

P12246

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027824
AA Change: D38E

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027824
Gene: ENSMUSG00000026542
AA Change: D38E

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PTX	21	224	2.27e-132	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased antibody productions, increased autoimmune antibodies, reduced amyloidosis and glomerulonephrosis depending on strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	T	C	17: 45,733,051	T94A	unknown	Het
1700025G04Rik	T	C	1: 151,915,508	R101G	probably damaging	Het
6430548M08Rik	T	A	8: 120,145,583	S83R	probably damaging	Het
9130019O22Rik	A	T	7: 127,384,680	S417T	probably benign	Het
A430089I19Rik	C	A	5: 94,303,254	V338F	probably benign	Het
Actn2	A	G	13: 12,278,913	S574P	probably benign	Het
Ank	A	T	15: 27,544,321	Y56F	probably damaging	Het
Ano7	A	G	1: 93,380,469	D74G	probably benign	Het
Apaf1	T	A	10: 91,037,002	T738S	probably damaging	Het
Arntl	A	T	7: 113,287,183	H149L	probably damaging	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Atp8a1	T	A	5: 67,702,981	D717V		Het
Baiap2l1	A	G	5: 144,275,877	S443P	probably benign	Het
Brix1	T	C	15: 10,483,292		probably null	Het
C1qtnf6	T	C	15: 78,527,374	E34G	probably benign	Het
Chil3	A	C	3: 106,160,537		probably null	Het
Chmp4c	T	A	3: 10,367,138	L36Q	probably damaging	Het
Chrna2	T	A	14: 66,143,871		probably null	Het
Clec1a	C	T	6: 129,436,955	C57Y	probably damaging	Het
Clec7a	G	T	6: 129,468,922	T95K	probably damaging	Het
Csf1r	C	A	18: 61,130,324	S926R	probably damaging	Het
Dnajc9	A	G	14: 20,388,439	I61T	probably benign	Het
Extl1	T	G	4: 134,359,769	S493R	probably benign	Het
Fance	A	G	17: 28,326,174	D143G	probably benign	Het
Fcho2	C	T	13: 98,753,613		probably null	Het
Filip1	T	C	9: 79,818,074	S1088G	probably benign	Het
Gm10696	A	T	3: 94,175,549	H318Q	possibly damaging	Het
Gnat1	A	C	9: 107,675,985	M319R	possibly damaging	Het
Gpr132	A	T	12: 112,852,429	V259E	probably damaging	Het
Gprc5d	T	A	6: 135,116,454	M152L	probably benign	Het
Hif3a	C	T	7: 17,050,588	R244H	probably damaging	Het
Hivep3	T	C	4: 120,095,452	S322P	possibly damaging	Het
Il33	T	A	19: 29,958,925	F229I	probably damaging	Het
Il4ra	A	G	7: 125,575,778	D386G	probably benign	Het
Ino80	G	T	2: 119,458,127	H33N	probably benign	Het
Ip6k1	A	G	9: 108,045,582	D228G	unknown	Het
Mamdc2	C	T	19: 23,447,610	A40T	probably benign	Het
Meis3	T	C	7: 16,184,701	V357A	probably benign	Het
Mycbp2	T	C	14: 103,133,846	T4199A	probably benign	Het
Myo7b	A	T	18: 31,981,001	M1099K	probably benign	Het
Mzb1	A	T	18: 35,647,922	H104Q	probably benign	Het
Nfatc2	A	G	2: 168,571,264	L167P	probably benign	Het
Numa1	A	T	7: 102,000,910	S1283C	probably benign	Het
Nup98	T	G	7: 102,191,900		probably null	Het
Olfr1342	T	C	4: 118,690,018	I145V	probably benign	Het
Olfr476	T	C	7: 107,967,667	L90P	probably benign	Het
Pkhd1l1	A	G	15: 44,522,695	T1243A	possibly damaging	Het
Ptpro	C	T	6: 137,454,598	R1152W	probably damaging	Het
Ptprt	T	C	2: 161,547,364	T1270A	probably damaging	Het
Pwwp2b	A	C	7: 139,256,133	T497P	probably damaging	Het
Rab44	T	A	17: 29,139,444	V202E		Het
Rbfox1	C	T	16: 7,294,083	T191I	probably damaging	Het
Rufy4	A	G	1: 74,133,015	K299R	probably damaging	Het
Snip1	T	A	4: 125,072,919	S381T	probably damaging	Het
Spen	T	C	4: 141,472,650	I2889V	possibly damaging	Het
St3gal3	T	A	4: 117,957,442	D218V		Het
Sun1	A	G	5: 139,226,687	T70A	unknown	Het
Tbc1d23	C	T	16: 57,170,382	V678M	probably damaging	Het
Tdh	T	A	14: 63,495,757	Y195F	probably damaging	Het
Tescl	C	T	7: 24,333,861	R13H	possibly damaging	Het
Tfap2c	T	A	2: 172,557,357	M508K	probably benign	Het
Trappc4	A	G	9: 44,405,290	M136T	probably benign	Het
Tyk2	A	G	9: 21,105,054	C1207R	probably damaging	Het
Ugt2b36	T	C	5: 87,081,539	Y355C	probably damaging	Het
Vmn1r119	T	A	7: 21,011,647	H270L	probably benign	Het
Vmn2r20	G	A	6: 123,386,115	P570L	probably damaging	Het
Wnk1	A	C	6: 120,002,273	Y284*	probably null	Het
Yars2	C	T	16: 16,303,318	A112V	probably damaging	Het
Zer1	T	C	2: 30,105,012	N470S	probably damaging	Het
Zfp879	A	C	11: 50,832,681	V516G	possibly damaging	Het

Other mutations in Apcs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01590:Apcs	APN	1	172894467	missense	probably damaging	0.97
R0040:Apcs	UTSW	1	172894456	missense	probably benign
R0040:Apcs	UTSW	1	172894456	missense	probably benign
R0865:Apcs	UTSW	1	172894215	missense	probably benign	0.30
R1691:Apcs	UTSW	1	172894593	missense	probably damaging	1.00
R2158:Apcs	UTSW	1	172894533	missense	probably damaging	1.00
R3411:Apcs	UTSW	1	172894563	missense	probably damaging	1.00
R3949:Apcs	UTSW	1	172894692	missense	probably damaging	1.00
R4636:Apcs	UTSW	1	172894422	missense	probably damaging	1.00
R6911:Apcs	UTSW	1	172894185	missense	probably benign	0.02
R8143:Apcs	UTSW	1	172894333	missense	probably damaging	1.00
R8287:Apcs	UTSW	1	172894247	missense	possibly damaging	0.66
R8867:Apcs	UTSW	1	172894437	missense	possibly damaging	0.94
R9005:Apcs	UTSW	1	172894209	missense	probably benign	0.41
R9132:Apcs	UTSW	1	172894494	missense	probably damaging	0.97
R9329:Apcs	UTSW	1	172894824	missense	probably benign	0.00
RF005:Apcs	UTSW	1	172894242	missense	probably damaging	1.00
RF024:Apcs	UTSW	1	172894242	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCGATGTATAGGCTGTATTCTC -3'
(R):5'- AAGCATGGACAAGCTACTGC -3'

Sequencing Primer
(F):5'- ATAGGCTGTATTCTCCAACTTTTTC -3'
(R):5'- CTTTCAGAAGCCTTTTGTCAGACAGG -3'

Posted On

2019-06-26