Incidental Mutation 'R7218:Zer1'
ID561567
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Namezyg-11 related, cell cycle regulator
SynonymsC230075L19Rik, Zyg11bl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30097283-30124585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30105012 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 470 (N470S)
Ref Sequence ENSEMBL: ENSMUSP00000046441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
Predicted Effect probably damaging
Transcript: ENSMUST00000044751
AA Change: N470S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: N470S

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113677
AA Change: N457S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: N457S

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 30108220 critical splice donor site probably null
IGL01630:Zer1 APN 2 30101831 missense probably damaging 1.00
IGL02126:Zer1 APN 2 30104916 missense probably benign 0.10
IGL02338:Zer1 APN 2 30113393 missense probably damaging 1.00
IGL02817:Zer1 APN 2 30103394 missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 30101120 missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 30103543 missense probably benign 0.01
R0390:Zer1 UTSW 2 30108213 splice site probably benign
R0506:Zer1 UTSW 2 30101807 missense probably damaging 1.00
R0606:Zer1 UTSW 2 30104797 splice site probably benign
R0928:Zer1 UTSW 2 30101763 critical splice donor site probably null
R1167:Zer1 UTSW 2 30108246 missense probably benign 0.00
R1819:Zer1 UTSW 2 30110218 missense probably benign 0.18
R2040:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2041:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2042:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2092:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2168:Zer1 UTSW 2 30104875 missense probably damaging 1.00
R2243:Zer1 UTSW 2 30101127 missense probably damaging 0.99
R2254:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2255:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2311:Zer1 UTSW 2 30101822 missense probably damaging 0.99
R2993:Zer1 UTSW 2 30101897 missense probably damaging 1.00
R3010:Zer1 UTSW 2 30113285 missense probably benign 0.13
R3731:Zer1 UTSW 2 30110911 missense probably benign 0.44
R4038:Zer1 UTSW 2 30107523 missense probably damaging 1.00
R5241:Zer1 UTSW 2 30104970 missense probably damaging 1.00
R5433:Zer1 UTSW 2 30100986 intron probably benign
R5443:Zer1 UTSW 2 30110996 missense probably damaging 1.00
R5524:Zer1 UTSW 2 30104854 missense probably damaging 1.00
R5936:Zer1 UTSW 2 30107667 missense probably damaging 0.97
R5999:Zer1 UTSW 2 30104997 missense probably damaging 1.00
R6598:Zer1 UTSW 2 30113274 missense probably damaging 1.00
R6965:Zer1 UTSW 2 30101047 missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30111021 missense probably benign 0.00
R7190:Zer1 UTSW 2 30103432 missense probably damaging 1.00
R7252:Zer1 UTSW 2 30101892 missense probably damaging 0.99
R7383:Zer1 UTSW 2 30111241 missense probably damaging 1.00
R7417:Zer1 UTSW 2 30102822 missense probably damaging 1.00
R7459:Zer1 UTSW 2 30113325 missense probably damaging 1.00
R7463:Zer1 UTSW 2 30113437 start gained probably benign
R7477:Zer1 UTSW 2 30107976 missense probably null 0.34
R7719:Zer1 UTSW 2 30111231 missense probably damaging 1.00
X0026:Zer1 UTSW 2 30104895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATTGTCCACCTGGCAGAC -3'
(R):5'- ACAGCAAGTATTAGTTGAGCCTG -3'

Sequencing Primer
(F):5'- CCAGGGCATTGCACAAGTG -3'
(R):5'- AGTTAAAAGCTAGCCCTGGC -3'
Posted On2019-06-26