Mutagenetix > Incidental Mutations

Incidental Mutation 'R7218:Tfap2c'

561571

Institutional Source

Beutler Lab

Gene Symbol

Tfap2c

Ensembl Gene

ENSMUSG00000028640

Gene Name

transcription factor AP-2, gamma

Synonyms

Tcfap2c, Stra2, AP2gamma, Ap-2.2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

172549593-172558622 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 172557357 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 508 (M508K)

Ref Sequence

ENSEMBL: ENSMUSP00000096657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030391] [ENSMUST00000099058] [ENSMUST00000170744]

Predicted Effect

probably benign
Transcript: ENSMUST00000030391
AA Change: M444K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000030391
Gene: ENSMUSG00000028640
AA Change: M444K

Domain	Start	End	E-Value	Type
low complexity region	54	66	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	148	168	N/A	INTRINSIC
Pfam:TF_AP-2	219	427	2.1e-102	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099058
AA Change: M508K

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000096657
Gene: ENSMUSG00000028640
AA Change: M508K

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	118	130	N/A	INTRINSIC
low complexity region	176	188	N/A	INTRINSIC
low complexity region	212	232	N/A	INTRINSIC
Pfam:TF_AP-2	285	486	2e-92	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170744
AA Change: M483K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000129922
Gene: ENSMUSG00000028640
AA Change: M483K

Domain	Start	End	E-Value	Type
low complexity region	93	105	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
low complexity region	187	207	N/A	INTRINSIC
Pfam:TF_AP-2	258	466	4.4e-102	PFAM

Meta Mutation Damage Score

0.026

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sequence-specific DNA-binding transcription factor involved in the activation of several developmental genes. The encoded protein can act as either a homodimer or heterodimer with other family members and is induced during retinoic acid-mediated differentiation. It plays a role in the development of the eyes, face, body wall, limbs, and neural tube. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation, failure to establish a normal maternal-embryonic interface, malformed extra-embryonic tissues, and early embryonic lethality due to placental malfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	T	C	17: 45,733,051	T94A	unknown	Het
1700025G04Rik	T	C	1: 151,915,508	R101G	probably damaging	Het
6430548M08Rik	T	A	8: 120,145,583	S83R	probably damaging	Het
9130019O22Rik	A	T	7: 127,384,680	S417T	probably benign	Het
A430089I19Rik	C	A	5: 94,303,254	V338F	probably benign	Het
Actn2	A	G	13: 12,278,913	S574P	probably benign	Het
Ank	A	T	15: 27,544,321	Y56F	probably damaging	Het
Ano7	A	G	1: 93,380,469	D74G	probably benign	Het
Apaf1	T	A	10: 91,037,002	T738S	probably damaging	Het
Apcs	A	T	1: 172,894,664	D38E	possibly damaging	Het
Arntl	A	T	7: 113,287,183	H149L	probably damaging	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Atp8a1	T	A	5: 67,702,981	D717V		Het
Baiap2l1	A	G	5: 144,275,877	S443P	probably benign	Het
Brix1	T	C	15: 10,483,292		probably null	Het
C1qtnf6	T	C	15: 78,527,374	E34G	probably benign	Het
Chil3	A	C	3: 106,160,537		probably null	Het
Chmp4c	T	A	3: 10,367,138	L36Q	probably damaging	Het
Chrna2	T	A	14: 66,143,871		probably null	Het
Clec1a	C	T	6: 129,436,955	C57Y	probably damaging	Het
Clec7a	G	T	6: 129,468,922	T95K	probably damaging	Het
Csf1r	C	A	18: 61,130,324	S926R	probably damaging	Het
Dnajc9	A	G	14: 20,388,439	I61T	probably benign	Het
Extl1	T	G	4: 134,359,769	S493R	probably benign	Het
Fance	A	G	17: 28,326,174	D143G	probably benign	Het
Fcho2	C	T	13: 98,753,613		probably null	Het
Filip1	T	C	9: 79,818,074	S1088G	probably benign	Het
Gm10696	A	T	3: 94,175,549	H318Q	possibly damaging	Het
Gnat1	A	C	9: 107,675,985	M319R	possibly damaging	Het
Gpr132	A	T	12: 112,852,429	V259E	probably damaging	Het
Gprc5d	T	A	6: 135,116,454	M152L	probably benign	Het
Hif3a	C	T	7: 17,050,588	R244H	probably damaging	Het
Hivep3	T	C	4: 120,095,452	S322P	possibly damaging	Het
Il33	T	A	19: 29,958,925	F229I	probably damaging	Het
Il4ra	A	G	7: 125,575,778	D386G	probably benign	Het
Ino80	G	T	2: 119,458,127	H33N	probably benign	Het
Ip6k1	A	G	9: 108,045,582	D228G	unknown	Het
Mamdc2	C	T	19: 23,447,610	A40T	probably benign	Het
Meis3	T	C	7: 16,184,701	V357A	probably benign	Het
Mycbp2	T	C	14: 103,133,846	T4199A	probably benign	Het
Myo7b	A	T	18: 31,981,001	M1099K	probably benign	Het
Mzb1	A	T	18: 35,647,922	H104Q	probably benign	Het
Nfatc2	A	G	2: 168,571,264	L167P	probably benign	Het
Numa1	A	T	7: 102,000,910	S1283C	probably benign	Het
Nup98	T	G	7: 102,191,900		probably null	Het
Olfr1342	T	C	4: 118,690,018	I145V	probably benign	Het
Olfr476	T	C	7: 107,967,667	L90P	probably benign	Het
Pkhd1l1	A	G	15: 44,522,695	T1243A	possibly damaging	Het
Ptpro	C	T	6: 137,454,598	R1152W	probably damaging	Het
Ptprt	T	C	2: 161,547,364	T1270A	probably damaging	Het
Pwwp2b	A	C	7: 139,256,133	T497P	probably damaging	Het
Rab44	T	A	17: 29,139,444	V202E		Het
Rbfox1	C	T	16: 7,294,083	T191I	probably damaging	Het
Rufy4	A	G	1: 74,133,015	K299R	probably damaging	Het
Snip1	T	A	4: 125,072,919	S381T	probably damaging	Het
Spen	T	C	4: 141,472,650	I2889V	possibly damaging	Het
St3gal3	T	A	4: 117,957,442	D218V		Het
Sun1	A	G	5: 139,226,687	T70A	unknown	Het
Tbc1d23	C	T	16: 57,170,382	V678M	probably damaging	Het
Tdh	T	A	14: 63,495,757	Y195F	probably damaging	Het
Tescl	C	T	7: 24,333,861	R13H	possibly damaging	Het
Trappc4	A	G	9: 44,405,290	M136T	probably benign	Het
Tyk2	A	G	9: 21,105,054	C1207R	probably damaging	Het
Ugt2b36	T	C	5: 87,081,539	Y355C	probably damaging	Het
Vmn1r119	T	A	7: 21,011,647	H270L	probably benign	Het
Vmn2r20	G	A	6: 123,386,115	P570L	probably damaging	Het
Wnk1	A	C	6: 120,002,273	Y284*	probably null	Het
Yars2	C	T	16: 16,303,318	A112V	probably damaging	Het
Zer1	T	C	2: 30,105,012	N470S	probably damaging	Het
Zfp879	A	C	11: 50,832,681	V516G	possibly damaging	Het

Other mutations in Tfap2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Tfap2c	APN	2	172551518	missense	probably damaging	0.98
IGL02986:Tfap2c	APN	2	172557251	missense	probably damaging	1.00
IGL03151:Tfap2c	APN	2	172557190	nonsense	probably null
R0268:Tfap2c	UTSW	2	172551503	missense	probably benign	0.01
R0344:Tfap2c	UTSW	2	172551503	missense	probably benign	0.01
R1982:Tfap2c	UTSW	2	172557236	missense	probably damaging	0.98
R3120:Tfap2c	UTSW	2	172557095	missense	possibly damaging	0.96
R4038:Tfap2c	UTSW	2	172556190	missense	probably damaging	0.96
R4498:Tfap2c	UTSW	2	172557182	nonsense	probably null
R4570:Tfap2c	UTSW	2	172557327	missense	probably damaging	1.00
R4855:Tfap2c	UTSW	2	172551518	missense	probably damaging	0.98
R5061:Tfap2c	UTSW	2	172552027	missense	probably damaging	1.00
R5610:Tfap2c	UTSW	2	172549858	missense	probably benign	0.06
R6706:Tfap2c	UTSW	2	172557356	missense	probably benign	0.26
R7228:Tfap2c	UTSW	2	172551572	missense	probably benign	0.01
R7502:Tfap2c	UTSW	2	172551719	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGGAGCCGAACATACAAAACTG -3'
(R):5'- CTTCAGGATAGCATGTCCAGGG -3'

Sequencing Primer
(F):5'- AAAACTGTTTGTCTCATTTCAGCCTG -3'
(R):5'- TAGCATGTCCAGGGTTAAATGG -3'

Posted On

2019-06-26