Mutagenetix > Incidental Mutation

Incidental Mutation 'R7218:Spen'

561579

Institutional Source

Beutler Lab

Gene Symbol

Spen

Ensembl Gene

ENSMUSG00000040761

Gene Name

spen family transcription repressor

Synonyms

Mint

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141467890-141538597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141472650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 2889 (I2889V)

Ref Sequence

ENSEMBL: ENSMUSP00000101412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078886
AA Change: I2866V

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: I2866V

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	617	632	N/A	INTRINSIC
low complexity region	669	691	N/A	INTRINSIC
low complexity region	695	720	N/A	INTRINSIC
low complexity region	749	773	N/A	INTRINSIC
coiled coil region	800	825	N/A	INTRINSIC
low complexity region	830	841	N/A	INTRINSIC
internal_repeat_2	844	954	6.27e-5	PROSPERO
coiled coil region	1494	1522	N/A	INTRINSIC
low complexity region	1587	1627	N/A	INTRINSIC
low complexity region	1635	1641	N/A	INTRINSIC
low complexity region	1642	1671	N/A	INTRINSIC
low complexity region	1747	1758	N/A	INTRINSIC
low complexity region	1810	1823	N/A	INTRINSIC
low complexity region	1888	1903	N/A	INTRINSIC
low complexity region	1940	1955	N/A	INTRINSIC
low complexity region	2003	2012	N/A	INTRINSIC
internal_repeat_2	2015	2115	6.27e-5	PROSPERO
low complexity region	2127	2147	N/A	INTRINSIC
low complexity region	2169	2191	N/A	INTRINSIC
low complexity region	2207	2219	N/A	INTRINSIC
low complexity region	2304	2323	N/A	INTRINSIC
low complexity region	2332	2371	N/A	INTRINSIC
low complexity region	2396	2413	N/A	INTRINSIC
low complexity region	2518	2533	N/A	INTRINSIC
low complexity region	2545	2555	N/A	INTRINSIC
low complexity region	2696	2722	N/A	INTRINSIC
low complexity region	2931	2942	N/A	INTRINSIC
low complexity region	2994	3006	N/A	INTRINSIC
low complexity region	3192	3212	N/A	INTRINSIC
low complexity region	3299	3337	N/A	INTRINSIC
Pfam:SPOC	3465	3586	2.7e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105786
AA Change: I2889V

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: I2889V

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	692	714	N/A	INTRINSIC
low complexity region	718	743	N/A	INTRINSIC
low complexity region	772	796	N/A	INTRINSIC
coiled coil region	823	848	N/A	INTRINSIC
low complexity region	853	864	N/A	INTRINSIC
internal_repeat_2	867	977	8.58e-5	PROSPERO
coiled coil region	1517	1545	N/A	INTRINSIC
low complexity region	1610	1650	N/A	INTRINSIC
low complexity region	1658	1664	N/A	INTRINSIC
low complexity region	1665	1694	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1833	1846	N/A	INTRINSIC
low complexity region	1911	1926	N/A	INTRINSIC
low complexity region	1963	1978	N/A	INTRINSIC
low complexity region	2026	2035	N/A	INTRINSIC
internal_repeat_2	2038	2138	8.58e-5	PROSPERO
low complexity region	2150	2170	N/A	INTRINSIC
low complexity region	2192	2214	N/A	INTRINSIC
low complexity region	2230	2242	N/A	INTRINSIC
low complexity region	2327	2346	N/A	INTRINSIC
low complexity region	2355	2394	N/A	INTRINSIC
low complexity region	2419	2436	N/A	INTRINSIC
low complexity region	2541	2556	N/A	INTRINSIC
low complexity region	2568	2578	N/A	INTRINSIC
low complexity region	2719	2745	N/A	INTRINSIC
low complexity region	2954	2965	N/A	INTRINSIC
low complexity region	3017	3029	N/A	INTRINSIC
low complexity region	3215	3235	N/A	INTRINSIC
low complexity region	3322	3360	N/A	INTRINSIC
Pfam:SPOC	3488	3609	2.7e-29	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	T	C	17: 45,733,051	T94A	unknown	Het
1700025G04Rik	T	C	1: 151,915,508	R101G	probably damaging	Het
6430548M08Rik	T	A	8: 120,145,583	S83R	probably damaging	Het
9130019O22Rik	A	T	7: 127,384,680	S417T	probably benign	Het
A430089I19Rik	C	A	5: 94,303,254	V338F	probably benign	Het
Actn2	A	G	13: 12,278,913	S574P	probably benign	Het
Ank	A	T	15: 27,544,321	Y56F	probably damaging	Het
Ano7	A	G	1: 93,380,469	D74G	probably benign	Het
Apaf1	T	A	10: 91,037,002	T738S	probably damaging	Het
Apcs	A	T	1: 172,894,664	D38E	possibly damaging	Het
Arntl	A	T	7: 113,287,183	H149L	probably damaging	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Atp8a1	T	A	5: 67,702,981	D717V		Het
Baiap2l1	A	G	5: 144,275,877	S443P	probably benign	Het
Brix1	T	C	15: 10,483,292		probably null	Het
C1qtnf6	T	C	15: 78,527,374	E34G	probably benign	Het
Chil3	A	C	3: 106,160,537		probably null	Het
Chmp4c	T	A	3: 10,367,138	L36Q	probably damaging	Het
Chrna2	T	A	14: 66,143,871		probably null	Het
Clec1a	C	T	6: 129,436,955	C57Y	probably damaging	Het
Clec7a	G	T	6: 129,468,922	T95K	probably damaging	Het
Csf1r	C	A	18: 61,130,324	S926R	probably damaging	Het
Dnajc9	A	G	14: 20,388,439	I61T	probably benign	Het
Extl1	T	G	4: 134,359,769	S493R	probably benign	Het
Fance	A	G	17: 28,326,174	D143G	probably benign	Het
Fcho2	C	T	13: 98,753,613		probably null	Het
Filip1	T	C	9: 79,818,074	S1088G	probably benign	Het
Gm10696	A	T	3: 94,175,549	H318Q	possibly damaging	Het
Gnat1	A	C	9: 107,675,985	M319R	possibly damaging	Het
Gpr132	A	T	12: 112,852,429	V259E	probably damaging	Het
Gprc5d	T	A	6: 135,116,454	M152L	probably benign	Het
Hif3a	C	T	7: 17,050,588	R244H	probably damaging	Het
Hivep3	T	C	4: 120,095,452	S322P	possibly damaging	Het
Il33	T	A	19: 29,958,925	F229I	probably damaging	Het
Il4ra	A	G	7: 125,575,778	D386G	probably benign	Het
Ino80	G	T	2: 119,458,127	H33N	probably benign	Het
Ip6k1	A	G	9: 108,045,582	D228G	unknown	Het
Mamdc2	C	T	19: 23,447,610	A40T	probably benign	Het
Meis3	T	C	7: 16,184,701	V357A	probably benign	Het
Mycbp2	T	C	14: 103,133,846	T4199A	probably benign	Het
Myo7b	A	T	18: 31,981,001	M1099K	probably benign	Het
Mzb1	A	T	18: 35,647,922	H104Q	probably benign	Het
Nfatc2	A	G	2: 168,571,264	L167P	probably benign	Het
Numa1	A	T	7: 102,000,910	S1283C	probably benign	Het
Nup98	T	G	7: 102,191,900		probably null	Het
Olfr1342	T	C	4: 118,690,018	I145V	probably benign	Het
Olfr476	T	C	7: 107,967,667	L90P	probably benign	Het
Pkhd1l1	A	G	15: 44,522,695	T1243A	possibly damaging	Het
Ptpro	C	T	6: 137,454,598	R1152W	probably damaging	Het
Ptprt	T	C	2: 161,547,364	T1270A	probably damaging	Het
Pwwp2b	A	C	7: 139,256,133	T497P	probably damaging	Het
Rab44	T	A	17: 29,139,444	V202E		Het
Rbfox1	C	T	16: 7,294,083	T191I	probably damaging	Het
Rufy4	A	G	1: 74,133,015	K299R	probably damaging	Het
Snip1	T	A	4: 125,072,919	S381T	probably damaging	Het
St3gal3	T	A	4: 117,957,442	D218V		Het
Sun1	A	G	5: 139,226,687	T70A	unknown	Het
Tbc1d23	C	T	16: 57,170,382	V678M	probably damaging	Het
Tdh	T	A	14: 63,495,757	Y195F	probably damaging	Het
Tescl	C	T	7: 24,333,861	R13H	possibly damaging	Het
Tfap2c	T	A	2: 172,557,357	M508K	probably benign	Het
Trappc4	A	G	9: 44,405,290	M136T	probably benign	Het
Tyk2	A	G	9: 21,105,054	C1207R	probably damaging	Het
Ugt2b36	T	C	5: 87,081,539	Y355C	probably damaging	Het
Vmn1r119	T	A	7: 21,011,647	H270L	probably benign	Het
Vmn2r20	G	A	6: 123,386,115	P570L	probably damaging	Het
Wnk1	A	C	6: 120,002,273	Y284*	probably null	Het
Yars2	C	T	16: 16,303,318	A112V	probably damaging	Het
Zer1	T	C	2: 30,105,012	N470S	probably damaging	Het
Zfp879	A	C	11: 50,832,681	V516G	possibly damaging	Het

Other mutations in Spen

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Spen	APN	4	141489901	missense	unknown
IGL01357:Spen	APN	4	141517113	missense	unknown
IGL02184:Spen	APN	4	141487606	missense	unknown
IGL02226:Spen	APN	4	141478146	missense	unknown
IGL02321:Spen	APN	4	141517130	missense	unknown
IGL02350:Spen	APN	4	141477579	missense	unknown
IGL02357:Spen	APN	4	141477579	missense	unknown
IGL02627:Spen	APN	4	141473015	missense	probably damaging	0.99
IGL02683:Spen	APN	4	141471645	missense	probably benign	0.06
IGL02945:Spen	APN	4	141494313	missense	unknown
IGL02950:Spen	APN	4	141469508	missense	probably damaging	1.00
IGL03008:Spen	APN	4	141476137	missense	possibly damaging	0.70
IGL03019:Spen	APN	4	141478916	missense	unknown
IGL03038:Spen	APN	4	141538239	missense	unknown
IGL03334:Spen	APN	4	141469969	missense	probably damaging	1.00
filtered	UTSW	4	141477372	missense	unknown
mentholated	UTSW	4	141469400	missense	possibly damaging	0.78
R0105:Spen	UTSW	4	141469810	splice site	probably benign
R0268:Spen	UTSW	4	141477557	missense	unknown
R0359:Spen	UTSW	4	141516870	missense	unknown
R0394:Spen	UTSW	4	141474203	missense	probably benign	0.03
R0423:Spen	UTSW	4	141479336	missense	unknown
R0433:Spen	UTSW	4	141483758	missense	unknown
R0462:Spen	UTSW	4	141473651	missense	probably damaging	1.00
R0687:Spen	UTSW	4	141488028	missense	unknown
R0699:Spen	UTSW	4	141474391	missense	possibly damaging	0.72
R0865:Spen	UTSW	4	141471870	missense	probably benign	0.11
R0918:Spen	UTSW	4	141485564	missense	unknown
R1034:Spen	UTSW	4	141475752	missense	probably benign	0.33
R1341:Spen	UTSW	4	141469400	missense	possibly damaging	0.78
R1401:Spen	UTSW	4	141471821	missense	probably damaging	0.98
R1509:Spen	UTSW	4	141475635	missense	probably benign	0.00
R1509:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R1561:Spen	UTSW	4	141472383	nonsense	probably null
R1589:Spen	UTSW	4	141488024	missense	unknown
R1640:Spen	UTSW	4	141468943	missense	probably damaging	0.98
R1758:Spen	UTSW	4	141476375	missense	unknown
R1764:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R1824:Spen	UTSW	4	141472785	missense	probably damaging	1.00
R1899:Spen	UTSW	4	141470343	missense	probably benign	0.17
R1916:Spen	UTSW	4	141472598	missense	probably damaging	1.00
R2011:Spen	UTSW	4	141473329	missense	probably damaging	1.00
R2295:Spen	UTSW	4	141477273	missense	unknown
R2379:Spen	UTSW	4	141516927	missense	unknown
R2404:Spen	UTSW	4	141477905	missense	unknown
R3719:Spen	UTSW	4	141517183	missense	unknown
R3889:Spen	UTSW	4	141477881	missense	unknown
R3945:Spen	UTSW	4	141477353	missense	unknown
R4227:Spen	UTSW	4	141522147	missense	unknown
R4326:Spen	UTSW	4	141477372	missense	unknown
R4382:Spen	UTSW	4	141473139	missense	possibly damaging	0.88
R4542:Spen	UTSW	4	141476786	missense	unknown
R4757:Spen	UTSW	4	141473079	nonsense	probably null
R4771:Spen	UTSW	4	141472596	missense	probably benign	0.14
R5072:Spen	UTSW	4	141522302	missense	unknown
R5121:Spen	UTSW	4	141476099	missense	probably benign	0.00
R5176:Spen	UTSW	4	141476276	missense	unknown
R5290:Spen	UTSW	4	141473816	missense	probably damaging	1.00
R5291:Spen	UTSW	4	141488079	missense	unknown
R5293:Spen	UTSW	4	141472406	missense	possibly damaging	0.89
R5347:Spen	UTSW	4	141471485	missense	probably benign	0.26
R5511:Spen	UTSW	4	141475064	missense	possibly damaging	0.86
R5511:Spen	UTSW	4	141516838	missense	unknown
R5772:Spen	UTSW	4	141478184	missense	unknown
R5834:Spen	UTSW	4	141471843	missense	possibly damaging	0.63
R5858:Spen	UTSW	4	141473871	missense	probably benign	0.05
R6214:Spen	UTSW	4	141479112	missense	unknown
R6232:Spen	UTSW	4	141517022	missense	unknown
R6345:Spen	UTSW	4	141471633	missense	possibly damaging	0.86
R6419:Spen	UTSW	4	141476310	missense	unknown
R6455:Spen	UTSW	4	141475509	missense	probably damaging	0.97
R6979:Spen	UTSW	4	141478063	missense	unknown
R6994:Spen	UTSW	4	141493459	missense	unknown
R7018:Spen	UTSW	4	141493444	missense	unknown
R7040:Spen	UTSW	4	141494382	missense	unknown
R7127:Spen	UTSW	4	141476108	missense	possibly damaging	0.53
R7234:Spen	UTSW	4	141479135	missense	unknown
R7316:Spen	UTSW	4	141477054	missense	unknown
R7350:Spen	UTSW	4	141479385	missense	unknown
R7356:Spen	UTSW	4	141471924	nonsense	probably null
R7400:Spen	UTSW	4	141473741	missense	probably damaging	1.00
R7470:Spen	UTSW	4	141479294	missense	unknown
R7698:Spen	UTSW	4	141472845	missense	probably damaging	1.00
R7858:Spen	UTSW	4	141488131	splice site	probably null
R8033:Spen	UTSW	4	141471746	missense	probably benign	0.03
R8064:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R8159:Spen	UTSW	4	141475003	missense	possibly damaging	0.53
R8187:Spen	UTSW	4	141472905	missense	possibly damaging	0.93
R8463:Spen	UTSW	4	141522279	missense	unknown
R8557:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8558:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8672:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8673:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8674:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8714:Spen	UTSW	4	141488003	missense	unknown
R8735:Spen	UTSW	4	141469818	missense	probably benign	0.32
R8762:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R8877:Spen	UTSW	4	141471826	nonsense	probably null
R8878:Spen	UTSW	4	141477209	missense	unknown
R8937:Spen	UTSW	4	141474063	missense	probably damaging	1.00
R8939:Spen	UTSW	4	141475658	missense	possibly damaging	0.72
R8968:Spen	UTSW	4	141470390	missense	probably benign	0.02
R8971:Spen	UTSW	4	141474578	missense	possibly damaging	0.53
R9016:Spen	UTSW	4	141473627	missense	probably damaging	1.00
R9072:Spen	UTSW	4	141476391	missense	unknown
R9073:Spen	UTSW	4	141476391	missense	unknown
R9120:Spen	UTSW	4	141472922	missense
R9136:Spen	UTSW	4	141522312	missense	unknown
R9138:Spen	UTSW	4	141469486	missense	probably damaging	1.00
R9150:Spen	UTSW	4	141517157	missense	unknown
R9225:Spen	UTSW	4	141475632	missense	possibly damaging	0.53
R9492:Spen	UTSW	4	141471787	missense	probably benign	0.26
R9537:Spen	UTSW	4	141471704	missense	probably benign	0.15
R9537:Spen	UTSW	4	141516845	small deletion	probably benign
T0722:Spen	UTSW	4	141474353	missense	probably benign	0.33
T0975:Spen	UTSW	4	141474353	missense	probably benign	0.33
Z1088:Spen	UTSW	4	141477976	missense	unknown
Z1088:Spen	UTSW	4	141477977	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GTTAGCTGGCTGAAGGACCTTG -3'
(R):5'- GGACATCGAGTTTCAGCAGTC -3'

Sequencing Primer
(F):5'- AAGGACCTTGGTCTCGATTTTCAGAG -3'
(R):5'- CGAGTTTCAGCAGTCAGTATCCAAG -3'

Posted On

2019-06-26