Mutagenetix > Incidental Mutations

Incidental Mutation 'R7218:Baiap2l1'

561584

Institutional Source

Beutler Lab

Gene Symbol

Baiap2l1

Ensembl Gene

ENSMUSG00000038859

Gene Name

BAI1-associated protein 2-like 1

Synonyms

IRTKS, 1300006M19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144264526-144358112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 144275877 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 443 (S443P)

Ref Sequence

ENSEMBL: ENSMUSP00000053129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]

PDB Structure

Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000055190
AA Change: S443P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: S443P

Domain	Start	End	E-Value	Type
Pfam:IMD	16	236	4.4e-65	PFAM
SH3	343	402	1.42e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155491

SMART Domains

Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

Domain	Start	End	E-Value	Type
Pfam:DUF2367	27	90	1.1e-24	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	T	C	17: 45,733,051	T94A	unknown	Het
1700025G04Rik	T	C	1: 151,915,508	R101G	probably damaging	Het
6430548M08Rik	T	A	8: 120,145,583	S83R	probably damaging	Het
9130019O22Rik	A	T	7: 127,384,680	S417T	probably benign	Het
A430089I19Rik	C	A	5: 94,303,254	V338F	probably benign	Het
Actn2	A	G	13: 12,278,913	S574P	probably benign	Het
Ank	A	T	15: 27,544,321	Y56F	probably damaging	Het
Ano7	A	G	1: 93,380,469	D74G	probably benign	Het
Apaf1	T	A	10: 91,037,002	T738S	probably damaging	Het
Apcs	A	T	1: 172,894,664	D38E	possibly damaging	Het
Arntl	A	T	7: 113,287,183	H149L	probably damaging	Het
Asap1	G	A	15: 64,130,250	T404M	probably damaging	Het
Atp8a1	T	A	5: 67,702,981	D717V		Het
Brix1	T	C	15: 10,483,292		probably null	Het
C1qtnf6	T	C	15: 78,527,374	E34G	probably benign	Het
Chil3	A	C	3: 106,160,537		probably null	Het
Chmp4c	T	A	3: 10,367,138	L36Q	probably damaging	Het
Chrna2	T	A	14: 66,143,871		probably null	Het
Clec1a	C	T	6: 129,436,955	C57Y	probably damaging	Het
Clec7a	G	T	6: 129,468,922	T95K	probably damaging	Het
Csf1r	C	A	18: 61,130,324	S926R	probably damaging	Het
Dnajc9	A	G	14: 20,388,439	I61T	probably benign	Het
Extl1	T	G	4: 134,359,769	S493R	probably benign	Het
Fance	A	G	17: 28,326,174	D143G	probably benign	Het
Fcho2	C	T	13: 98,753,613		probably null	Het
Filip1	T	C	9: 79,818,074	S1088G	probably benign	Het
Gm10696	A	T	3: 94,175,549	H318Q	possibly damaging	Het
Gnat1	A	C	9: 107,675,985	M319R	possibly damaging	Het
Gpr132	A	T	12: 112,852,429	V259E	probably damaging	Het
Gprc5d	T	A	6: 135,116,454	M152L	probably benign	Het
Hif3a	C	T	7: 17,050,588	R244H	probably damaging	Het
Hivep3	T	C	4: 120,095,452	S322P	possibly damaging	Het
Il33	T	A	19: 29,958,925	F229I	probably damaging	Het
Il4ra	A	G	7: 125,575,778	D386G	probably benign	Het
Ino80	G	T	2: 119,458,127	H33N	probably benign	Het
Ip6k1	A	G	9: 108,045,582	D228G	unknown	Het
Mamdc2	C	T	19: 23,447,610	A40T	probably benign	Het
Meis3	T	C	7: 16,184,701	V357A	probably benign	Het
Mycbp2	T	C	14: 103,133,846	T4199A	probably benign	Het
Myo7b	A	T	18: 31,981,001	M1099K	probably benign	Het
Mzb1	A	T	18: 35,647,922	H104Q	probably benign	Het
Nfatc2	A	G	2: 168,571,264	L167P	probably benign	Het
Numa1	A	T	7: 102,000,910	S1283C	probably benign	Het
Nup98	T	G	7: 102,191,900		probably null	Het
Olfr1342	T	C	4: 118,690,018	I145V	probably benign	Het
Olfr476	T	C	7: 107,967,667	L90P	probably benign	Het
Pkhd1l1	A	G	15: 44,522,695	T1243A	possibly damaging	Het
Ptpro	C	T	6: 137,454,598	R1152W	probably damaging	Het
Ptprt	T	C	2: 161,547,364	T1270A	probably damaging	Het
Pwwp2b	A	C	7: 139,256,133	T497P	probably damaging	Het
Rab44	T	A	17: 29,139,444	V202E		Het
Rbfox1	C	T	16: 7,294,083	T191I	probably damaging	Het
Rufy4	A	G	1: 74,133,015	K299R	probably damaging	Het
Snip1	T	A	4: 125,072,919	S381T	probably damaging	Het
Spen	T	C	4: 141,472,650	I2889V	possibly damaging	Het
St3gal3	T	A	4: 117,957,442	D218V		Het
Sun1	A	G	5: 139,226,687	T70A	unknown	Het
Tbc1d23	C	T	16: 57,170,382	V678M	probably damaging	Het
Tdh	T	A	14: 63,495,757	Y195F	probably damaging	Het
Tescl	C	T	7: 24,333,861	R13H	possibly damaging	Het
Tfap2c	T	A	2: 172,557,357	M508K	probably benign	Het
Trappc4	A	G	9: 44,405,290	M136T	probably benign	Het
Tyk2	A	G	9: 21,105,054	C1207R	probably damaging	Het
Ugt2b36	T	C	5: 87,081,539	Y355C	probably damaging	Het
Vmn1r119	T	A	7: 21,011,647	H270L	probably benign	Het
Vmn2r20	G	A	6: 123,386,115	P570L	probably damaging	Het
Wnk1	A	C	6: 120,002,273	Y284*	probably null	Het
Yars2	C	T	16: 16,303,318	A112V	probably damaging	Het
Zer1	T	C	2: 30,105,012	N470S	probably damaging	Het
Zfp879	A	C	11: 50,832,681	V516G	possibly damaging	Het

Other mutations in Baiap2l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00789:Baiap2l1	APN	5	144285546	nonsense	probably null
IGL00789:Baiap2l1	APN	5	144286069	splice site	probably null
IGL00922:Baiap2l1	APN	5	144318967	missense	probably damaging	1.00
IGL01446:Baiap2l1	APN	5	144275913	missense	probably benign	0.10
IGL01603:Baiap2l1	APN	5	144280815	intron	probably benign
IGL02748:Baiap2l1	APN	5	144266605	intron	probably benign
IGL03348:Baiap2l1	APN	5	144278531	missense	probably benign	0.08
PIT4382001:Baiap2l1	UTSW	5	144278670	missense	possibly damaging	0.71
R0066:Baiap2l1	UTSW	5	144284562	missense	probably damaging	1.00
R0066:Baiap2l1	UTSW	5	144284562	missense	probably damaging	1.00
R0110:Baiap2l1	UTSW	5	144275891	missense	probably damaging	1.00
R0197:Baiap2l1	UTSW	5	144266010	missense	probably damaging	0.96
R0469:Baiap2l1	UTSW	5	144275891	missense	probably damaging	1.00
R0744:Baiap2l1	UTSW	5	144266641	missense	probably benign	0.21
R0755:Baiap2l1	UTSW	5	144284557	missense	probably damaging	0.97
R0765:Baiap2l1	UTSW	5	144277703	missense	probably damaging	0.99
R1051:Baiap2l1	UTSW	5	144286133	missense	probably damaging	1.00
R1809:Baiap2l1	UTSW	5	144324555	critical splice donor site	probably null
R3889:Baiap2l1	UTSW	5	144278535	missense	possibly damaging	0.67
R4451:Baiap2l1	UTSW	5	144278552	missense	probably damaging	1.00
R5093:Baiap2l1	UTSW	5	144278553	missense	probably damaging	1.00
R5471:Baiap2l1	UTSW	5	144282141	missense	probably benign	0.01
R5523:Baiap2l1	UTSW	5	144275958	missense	probably damaging	1.00
R5524:Baiap2l1	UTSW	5	144280949	missense	probably benign	0.01
R5586:Baiap2l1	UTSW	5	144282139	missense	probably damaging	0.99
R5603:Baiap2l1	UTSW	5	144265977	missense	probably damaging	1.00
R5735:Baiap2l1	UTSW	5	144286302	missense	probably damaging	1.00
R6353:Baiap2l1	UTSW	5	144282088	missense	possibly damaging	0.80
R6572:Baiap2l1	UTSW	5	144286302	missense	probably damaging	1.00
R6619:Baiap2l1	UTSW	5	144286106	missense	probably benign	0.22
R6981:Baiap2l1	UTSW	5	144285579	missense	possibly damaging	0.94
R7352:Baiap2l1	UTSW	5	144324626	missense	probably benign	0.03
R7662:Baiap2l1	UTSW	5	144357890	intron	probably benign
R7797:Baiap2l1	UTSW	5	144318950	missense	probably damaging	1.00
R7981:Baiap2l1	UTSW	5	144357890	intron	probably benign
R8170:Baiap2l1	UTSW	5	144277692	nonsense	probably null
R8308:Baiap2l1	UTSW	5	144277677	missense	probably benign	0.06
R8333:Baiap2l1	UTSW	5	144280881	missense	possibly damaging	0.89
X0022:Baiap2l1	UTSW	5	144278652	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGGAGACAGAGTAACATGC -3'
(R):5'- TGTAGCGCAGTACTGTCACC -3'

Sequencing Primer
(F):5'- TAACATGCAGGGAGGGCTTAG -3'
(R):5'- GTATGTCTGTGAACCACATGCAC -3'

Posted On

2019-06-26