Incidental Mutation 'R7218:9130019O22Rik'
ID 561599
Institutional Source Beutler Lab
Gene Symbol 9130019O22Rik
Ensembl Gene ENSMUSG00000030823
Gene Name RIKEN cDNA 9130019O22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7218 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127382260-127387166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127384680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 417 (S417T)
Ref Sequence ENSEMBL: ENSMUSP00000038195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049052] [ENSMUST00000164345] [ENSMUST00000165495]
AlphaFold G3X941
Predicted Effect probably benign
Transcript: ENSMUST00000049052
AA Change: S417T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038195
Gene: ENSMUSG00000030823
AA Change: S417T

DomainStartEndE-ValueType
KRAB 22 82 5.44e-25 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 6.88e-4 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 5.29e-5 SMART
ZnF_C2H2 236 258 4.87e-4 SMART
ZnF_C2H2 264 286 3.69e-4 SMART
ZnF_C2H2 292 314 1.47e-3 SMART
ZnF_C2H2 320 342 5.21e-4 SMART
ZnF_C2H2 348 370 1.45e-2 SMART
ZnF_C2H2 376 398 2.12e-4 SMART
ZnF_C2H2 404 427 1.45e-2 SMART
ZnF_C2H2 433 455 3.69e-4 SMART
ZnF_C2H2 461 483 6.67e-2 SMART
ZnF_C2H2 489 511 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164345
SMART Domains Protein: ENSMUSP00000131610
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 67 1.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165495
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Pwwp2b A C 7: 139,256,133 T497P probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in 9130019O22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:9130019O22Rik APN 7 127386544 unclassified probably benign
IGL03102:9130019O22Rik APN 7 127384779 missense probably benign 0.01
IGL03264:9130019O22Rik APN 7 127385639 unclassified probably benign
R1653:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R1692:9130019O22Rik UTSW 7 127384480 missense possibly damaging 0.71
R2042:9130019O22Rik UTSW 7 127385469 missense possibly damaging 0.93
R2132:9130019O22Rik UTSW 7 127386935 missense probably benign
R3768:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3769:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R3770:9130019O22Rik UTSW 7 127384863 unclassified probably benign
R4459:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4461:9130019O22Rik UTSW 7 127384745 missense probably damaging 0.98
R4839:9130019O22Rik UTSW 7 127385007 missense probably benign 0.32
R4903:9130019O22Rik UTSW 7 127385406 missense probably benign 0.02
R5231:9130019O22Rik UTSW 7 127385414 missense probably damaging 0.98
R5324:9130019O22Rik UTSW 7 127384907 unclassified probably benign
R5735:9130019O22Rik UTSW 7 127385407 missense possibly damaging 0.60
R5808:9130019O22Rik UTSW 7 127384913 unclassified probably benign
R6429:9130019O22Rik UTSW 7 127385042 unclassified probably benign
R6571:9130019O22Rik UTSW 7 127385138 unclassified probably benign
R6655:9130019O22Rik UTSW 7 127384340 missense possibly damaging 0.96
R6806:9130019O22Rik UTSW 7 127386594 unclassified probably benign
R6962:9130019O22Rik UTSW 7 127384315 missense possibly damaging 0.70
R7091:9130019O22Rik UTSW 7 127384362 missense possibly damaging 0.70
R7204:9130019O22Rik UTSW 7 127384346 missense possibly damaging 0.92
R7570:9130019O22Rik UTSW 7 127385283 missense probably benign 0.00
R7604:9130019O22Rik UTSW 7 127386535 missense unknown
R7661:9130019O22Rik UTSW 7 127384963 nonsense probably null
R7893:9130019O22Rik UTSW 7 127386544 unclassified probably benign
R8323:9130019O22Rik UTSW 7 127384449 missense possibly damaging 0.71
R9172:9130019O22Rik UTSW 7 127385454 missense probably benign 0.38
R9204:9130019O22Rik UTSW 7 127385160 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGGCTGGAATTTCAGAGC -3'
(R):5'- GTCATTCAATTGCCCTGATTGC -3'

Sequencing Primer
(F):5'- TTTCAGAGCTCTGGCGAAAG -3'
(R):5'- AATTGCCCTGATTGCTGCAAG -3'
Posted On 2019-06-26