Incidental Mutation 'R7218:Pwwp2b'
ID561600
Institutional Source Beutler Lab
Gene Symbol Pwwp2b
Ensembl Gene ENSMUSG00000060260
Gene NamePWWP domain containing 2B
SynonymsD930023J19Rik, Pwwp2, D7Ertd517e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7218 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139248482-139269903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 139256133 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 497 (T497P)
Ref Sequence ENSEMBL: ENSMUSP00000130888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093993] [ENSMUST00000172136]
Predicted Effect probably damaging
Transcript: ENSMUST00000093993
AA Change: T497P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091529
Gene: ENSMUSG00000060260
AA Change: T497P

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
PDB:4LD6|A 485 506 4e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000172136
AA Change: T497P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130888
Gene: ENSMUSG00000060260
AA Change: T497P

DomainStartEndE-ValueType
low complexity region 105 120 N/A INTRINSIC
low complexity region 145 165 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 381 401 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
Pfam:PWWP 498 583 5.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik T C 17: 45,733,051 T94A unknown Het
1700025G04Rik T C 1: 151,915,508 R101G probably damaging Het
6430548M08Rik T A 8: 120,145,583 S83R probably damaging Het
9130019O22Rik A T 7: 127,384,680 S417T probably benign Het
A430089I19Rik C A 5: 94,303,254 V338F probably benign Het
Actn2 A G 13: 12,278,913 S574P probably benign Het
Ank A T 15: 27,544,321 Y56F probably damaging Het
Ano7 A G 1: 93,380,469 D74G probably benign Het
Apaf1 T A 10: 91,037,002 T738S probably damaging Het
Apcs A T 1: 172,894,664 D38E possibly damaging Het
Arntl A T 7: 113,287,183 H149L probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Atp8a1 T A 5: 67,702,981 D717V Het
Baiap2l1 A G 5: 144,275,877 S443P probably benign Het
Brix1 T C 15: 10,483,292 probably null Het
C1qtnf6 T C 15: 78,527,374 E34G probably benign Het
Chil3 A C 3: 106,160,537 probably null Het
Chmp4c T A 3: 10,367,138 L36Q probably damaging Het
Chrna2 T A 14: 66,143,871 probably null Het
Clec1a C T 6: 129,436,955 C57Y probably damaging Het
Clec7a G T 6: 129,468,922 T95K probably damaging Het
Csf1r C A 18: 61,130,324 S926R probably damaging Het
Dnajc9 A G 14: 20,388,439 I61T probably benign Het
Extl1 T G 4: 134,359,769 S493R probably benign Het
Fance A G 17: 28,326,174 D143G probably benign Het
Fcho2 C T 13: 98,753,613 probably null Het
Filip1 T C 9: 79,818,074 S1088G probably benign Het
Gm10696 A T 3: 94,175,549 H318Q possibly damaging Het
Gnat1 A C 9: 107,675,985 M319R possibly damaging Het
Gpr132 A T 12: 112,852,429 V259E probably damaging Het
Gprc5d T A 6: 135,116,454 M152L probably benign Het
Hif3a C T 7: 17,050,588 R244H probably damaging Het
Hivep3 T C 4: 120,095,452 S322P possibly damaging Het
Il33 T A 19: 29,958,925 F229I probably damaging Het
Il4ra A G 7: 125,575,778 D386G probably benign Het
Ino80 G T 2: 119,458,127 H33N probably benign Het
Ip6k1 A G 9: 108,045,582 D228G unknown Het
Mamdc2 C T 19: 23,447,610 A40T probably benign Het
Meis3 T C 7: 16,184,701 V357A probably benign Het
Mycbp2 T C 14: 103,133,846 T4199A probably benign Het
Myo7b A T 18: 31,981,001 M1099K probably benign Het
Mzb1 A T 18: 35,647,922 H104Q probably benign Het
Nfatc2 A G 2: 168,571,264 L167P probably benign Het
Numa1 A T 7: 102,000,910 S1283C probably benign Het
Nup98 T G 7: 102,191,900 probably null Het
Olfr1342 T C 4: 118,690,018 I145V probably benign Het
Olfr476 T C 7: 107,967,667 L90P probably benign Het
Pkhd1l1 A G 15: 44,522,695 T1243A possibly damaging Het
Ptpro C T 6: 137,454,598 R1152W probably damaging Het
Ptprt T C 2: 161,547,364 T1270A probably damaging Het
Rab44 T A 17: 29,139,444 V202E Het
Rbfox1 C T 16: 7,294,083 T191I probably damaging Het
Rufy4 A G 1: 74,133,015 K299R probably damaging Het
Snip1 T A 4: 125,072,919 S381T probably damaging Het
Spen T C 4: 141,472,650 I2889V possibly damaging Het
St3gal3 T A 4: 117,957,442 D218V Het
Sun1 A G 5: 139,226,687 T70A unknown Het
Tbc1d23 C T 16: 57,170,382 V678M probably damaging Het
Tdh T A 14: 63,495,757 Y195F probably damaging Het
Tescl C T 7: 24,333,861 R13H possibly damaging Het
Tfap2c T A 2: 172,557,357 M508K probably benign Het
Trappc4 A G 9: 44,405,290 M136T probably benign Het
Tyk2 A G 9: 21,105,054 C1207R probably damaging Het
Ugt2b36 T C 5: 87,081,539 Y355C probably damaging Het
Vmn1r119 T A 7: 21,011,647 H270L probably benign Het
Vmn2r20 G A 6: 123,386,115 P570L probably damaging Het
Wnk1 A C 6: 120,002,273 Y284* probably null Het
Yars2 C T 16: 16,303,318 A112V probably damaging Het
Zer1 T C 2: 30,105,012 N470S probably damaging Het
Zfp879 A C 11: 50,832,681 V516G possibly damaging Het
Other mutations in Pwwp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Pwwp2b APN 7 139254855 nonsense probably null
IGL02209:Pwwp2b APN 7 139255105 missense probably damaging 1.00
IGL02938:Pwwp2b APN 7 139256143 missense probably damaging 1.00
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R0033:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R1491:Pwwp2b UTSW 7 139255963 missense probably damaging 1.00
R1636:Pwwp2b UTSW 7 139254842 missense probably benign 0.00
R1672:Pwwp2b UTSW 7 139254831 missense probably benign
R1793:Pwwp2b UTSW 7 139256365 missense probably damaging 0.97
R2016:Pwwp2b UTSW 7 139256151 missense possibly damaging 0.91
R2159:Pwwp2b UTSW 7 139254928 missense possibly damaging 0.87
R2228:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2229:Pwwp2b UTSW 7 139255188 missense probably damaging 1.00
R2380:Pwwp2b UTSW 7 139255450 missense probably damaging 1.00
R3023:Pwwp2b UTSW 7 139256194 missense probably damaging 1.00
R3933:Pwwp2b UTSW 7 139256034 missense possibly damaging 0.66
R4440:Pwwp2b UTSW 7 139255639 missense probably benign 0.09
R4844:Pwwp2b UTSW 7 139255586 missense probably benign 0.09
R4873:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R4875:Pwwp2b UTSW 7 139256062 missense possibly damaging 0.90
R5022:Pwwp2b UTSW 7 139255578 missense possibly damaging 0.81
R5446:Pwwp2b UTSW 7 139255150 missense probably damaging 0.96
R5656:Pwwp2b UTSW 7 139255971 missense possibly damaging 0.93
R6465:Pwwp2b UTSW 7 139256035 missense probably benign 0.01
R6578:Pwwp2b UTSW 7 139256112 missense probably damaging 1.00
R6774:Pwwp2b UTSW 7 139255987 missense probably benign 0.13
R7316:Pwwp2b UTSW 7 139256224 missense probably benign 0.29
X0017:Pwwp2b UTSW 7 139255806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGTGAATCTGTGTGCAGC -3'
(R):5'- AGCCTCAGTTATAGCTTTCCG -3'

Sequencing Primer
(F):5'- CGGACAGCCTGGATGAATTAAAATC -3'
(R):5'- AGTTATAGCTTTCCGATACATCCC -3'
Posted On2019-06-26